G1597277


Basic Information

Item Value
gene id G1597277
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 17907417 ~ 17907931 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1829000
tcactagccactttaaacaatgctaccttatataatgttacttacgctacattattcatctcatatgcatacgtatatactgtactctatatcatcgactgtatccttatgtaatacatgtatcactagccactttaactatgccactttgtttacatactcatctcatatgtatatactgtactcgataccatctactgtatcttgcctatgctgttctgtaccatcactcattcatatatccttatgtacatattctttatccccttacactgtgtacaagacagtagttttggaattgttagttagatgacttgttggttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatgtgacaaataaaatttgatttgattttgatttggtgaggacctgccttacaaccggcctacaagccctcagtccagcctctctcagcctattgcggacagtctgagcactgatggagag

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1829000 True 515 lncRNA 0.38 1 17907417 17907931
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110497449 LOC106609909 coding upstream 63657 17806915 ~ 17843760 (+)
LOC110497448 LOC106609908 coding upstream 157651 17740434 ~ 17749766 (+)
LOC110498668 LOC106609907 coding upstream 225497 17645109 ~ 17681920 (+)
LOC110497447 LOC106609905 coding upstream 262803 17625425 ~ 17644614 (+)
pold4 pold4 coding upstream 283939 17621396 ~ 17623478 (+)
LOC110497453 lrat coding downstream 26385 17934316 ~ 17936334 (+)
LOC110497454 LOC106609867 coding downstream 29071 17937002 ~ 17941545 (+)
LOC110498558 LOC106609924 coding downstream 48576 17956507 ~ 17962121 (+)
LOC110497458 LOC100135888 coding downstream 253166 18161097 ~ 18218659 (+)
LOC118941462 NA coding downstream 894796 18802727 ~ 18815594 (+)
G1597263 LOC106609911 non-coding upstream 8490 17893485 ~ 17898927 (+)
G1597251 NA non-coding upstream 45466 17861678 ~ 17861951 (+)
G1597246 NA non-coding upstream 55267 17851942 ~ 17852150 (+)
G1597245 LOC106592462 non-coding upstream 55658 17848349 ~ 17851759 (+)
G1597243 NA non-coding upstream 61459 17845739 ~ 17845958 (+)
G1597261 LOC106602564 non-coding downstream 4856 17912787 ~ 17992923 (+)
G1597307 NA non-coding downstream 56999 17964930 ~ 17966176 (+)
G1597334 NA non-coding downstream 98321 18006252 ~ 18006457 (+)
G1597295 NA non-coding downstream 99792 18007723 ~ 18018250 (+)
G1597336 NA non-coding downstream 117599 18025530 ~ 18032904 (+)
G1594955 NA other upstream 1133708 16765543 ~ 16773709 (+)
G1594895 NA other upstream 1229295 16675609 ~ 16678122 (+)
G1594737 LOC106610136 other upstream 1471050 16434453 ~ 16436367 (+)
G1594292 LOC106610101 other upstream 1623214 16279290 ~ 16284203 (+)
G1597342 LOC106609914 other downstream 135480 18043411 ~ 18104592 (+)
G1598786 NA other downstream 1124954 19032885 ~ 19033176 (+)
LOC110497472 LOC106609985 other downstream 1418497 19326377 ~ 19328349 (+)
G1598960 NA other downstream 1423810 19331741 ~ 19332220 (+)

Expression

G1597277 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1597277 Expression in each Bioproject

Bar chart with 19 bars.
G1597277 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network