G1597364



Basic Information


Item Value
gene id G1597364
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 18104780 ~ 18105037 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1829102
gtcttcccagcctggtgcaggtctacaattttgtttctggtgtcctttgacagctctttggtcttggccatagtggagtttggagtgtgactgtttgaggttgtggacaggtgtcttttatactgataacaagttcaaacaggtgccattaatacaggtaacgagtggaggacagaggagccttttaaagaagaagttacaggtctgtgagagccagaaatcttgcttgtttgtaggtgaccaaatgcttattttcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1829102 True 258 lncRNA 0.44 1 18104780 18105037
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498558 LOC106609924 coding upstream 142659 17956507 ~ 17962121 (+)
LOC110497454 LOC106609867 coding upstream 163235 17937002 ~ 17941545 (+)
LOC110497453 lrat coding upstream 168446 17934316 ~ 17936334 (+)
LOC110497449 LOC106609909 coding upstream 261020 17806915 ~ 17843760 (+)
LOC110497448 LOC106609908 coding upstream 355014 17740434 ~ 17749766 (+)
LOC110497458 LOC100135888 coding downstream 56060 18161097 ~ 18218659 (+)
LOC118941462 NA coding downstream 697690 18802727 ~ 18815594 (+)
LOC118941552 NA coding downstream 733515 18838552 ~ 18838607 (+)
LOC110497463 LOC106609940 coding downstream 1018672 19123709 ~ 19141362 (+)
LOC110497461 LOC106609942 coding downstream 1038133 19143170 ~ 19147993 (+)
G1597341 LOC106572245 non-coding upstream 61444 18038352 ~ 18043336 (+)
G1597336 NA non-coding upstream 71876 18025530 ~ 18032904 (+)
G1597295 NA non-coding upstream 86530 18007723 ~ 18018250 (+)
G1597334 NA non-coding upstream 98323 18006252 ~ 18006457 (+)
G1597261 LOC106602564 non-coding upstream 111857 17912787 ~ 17992923 (+)
G1597602 NA non-coding downstream 574 18105611 ~ 18105944 (+)
G1597626 NA non-coding downstream 28357 18133394 ~ 18133718 (+)
G1597628 NA non-coding downstream 30139 18135176 ~ 18135395 (+)
G1597634 NA non-coding downstream 34050 18139087 ~ 18139354 (+)
G1597649 NA non-coding downstream 49431 18154468 ~ 18154721 (+)
G1597342 LOC106609914 other upstream 188 18043411 ~ 18104592 (+)
pold4 pold4 other upstream 481307 17621396 ~ 17623478 (+)
G1594955 NA other upstream 1331071 16765543 ~ 16773709 (+)
G1594895 NA other upstream 1426658 16675609 ~ 16678122 (+)
G1598786 NA other downstream 927848 19032885 ~ 19033176 (+)
LOC110497472 LOC106609985 other downstream 1221391 19326377 ~ 19328349 (+)
G1598960 NA other downstream 1226704 19331741 ~ 19332220 (+)
G1598961 LOC107681197 other downstream 1227983 19333020 ~ 19333450 (+)
G1599186 NA other downstream 1287254 19392291 ~ 19418517 (+)

Expression


G1597364 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1597364 Expression in each Bioproject

Bar chart with 20 bars.
G1597364 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network