G1597602



Basic Information


Item Value
gene id G1597602
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 18105611 ~ 18105944 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1829374
gatactgttgtgaagaagtttaaagccggaattggatacaaaaatatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagacctctgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttctta

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1829374 True 334 lncRNA 0.44 1 18105611 18105944
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498558 LOC106609924 coding upstream 143490 17956507 ~ 17962121 (+)
LOC110497454 LOC106609867 coding upstream 164066 17937002 ~ 17941545 (+)
LOC110497453 lrat coding upstream 169277 17934316 ~ 17936334 (+)
LOC110497449 LOC106609909 coding upstream 261851 17806915 ~ 17843760 (+)
LOC110497448 LOC106609908 coding upstream 355845 17740434 ~ 17749766 (+)
LOC110497458 LOC100135888 coding downstream 55153 18161097 ~ 18218659 (+)
LOC118941462 NA coding downstream 696783 18802727 ~ 18815594 (+)
LOC118941552 NA coding downstream 732608 18838552 ~ 18838607 (+)
LOC110497463 LOC106609940 coding downstream 1017765 19123709 ~ 19141362 (+)
LOC110497461 LOC106609942 coding downstream 1037226 19143170 ~ 19147993 (+)
G1597364 NA non-coding upstream 574 18104780 ~ 18105037 (+)
G1597341 LOC106572245 non-coding upstream 62275 18038352 ~ 18043336 (+)
G1597336 NA non-coding upstream 72707 18025530 ~ 18032904 (+)
G1597295 NA non-coding upstream 87361 18007723 ~ 18018250 (+)
G1597334 NA non-coding upstream 99154 18006252 ~ 18006457 (+)
G1597626 NA non-coding downstream 27450 18133394 ~ 18133718 (+)
G1597628 NA non-coding downstream 29232 18135176 ~ 18135395 (+)
G1597634 NA non-coding downstream 33143 18139087 ~ 18139354 (+)
G1597649 NA non-coding downstream 48524 18154468 ~ 18154721 (+)
G1597734 NA non-coding downstream 125042 18230986 ~ 18231193 (+)
G1597342 LOC106609914 other upstream 1019 18043411 ~ 18104592 (+)
pold4 pold4 other upstream 482138 17621396 ~ 17623478 (+)
G1594955 NA other upstream 1331902 16765543 ~ 16773709 (+)
G1594895 NA other upstream 1427489 16675609 ~ 16678122 (+)
G1598786 NA other downstream 926941 19032885 ~ 19033176 (+)
LOC110497472 LOC106609985 other downstream 1220484 19326377 ~ 19328349 (+)
G1598960 NA other downstream 1225797 19331741 ~ 19332220 (+)
G1598961 LOC107681197 other downstream 1227076 19333020 ~ 19333450 (+)
G1599186 NA other downstream 1286347 19392291 ~ 19418517 (+)

Expression


G1597602 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1597602 Expression in each Bioproject

Bar chart with 17 bars.
G1597602 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network