G1597650



Basic Information


Item Value
gene id G1597650
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 18154491 ~ 18154721 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1829422
taccttatttacataagtattcagaccctttgctatgagactcgaaattgagctcaggtgcatcctgttttcattgatcatccttgagatgtttctacaacttgattggagtccacatgtggtaaattcaaattgattagacatgatttggaaaggcacacacctgtctatataaggtcccacagttgacagtgcatgtcagagcaaaaaaacaagtcatgaggtcaaagg

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1829422 True 231 lncRNA 0.39 1 18154491 18154721

Neighbor


gene id symbol gene type direction distance location
LOC118941355 NA coding downstream 4772 18146158 ~ 18149719 (-)
LOC110497456 LOC106609914 coding downstream 59962 18007657 ~ 18094529 (-)
LOC110497455 pdli3 coding downstream 148741 17980056 ~ 18005750 (-)
LOC110498559 LOC106602637 coding downstream 177770 17971731 ~ 17976721 (-)
LOC110497452 LOC106602564 coding downstream 233783 17912923 ~ 17920708 (-)
LOC110497459 LOC106609939 coding upstream 320675 18475396 ~ 18579393 (-)
LOC110497460 LOC106609941 coding upstream 993681 19148402 ~ 19184184 (-)
LOC110497466 LOC106609946 coding upstream 1064413 19219134 ~ 19228766 (-)
LOC110497469 LOC106609949 coding upstream 1098651 19253372 ~ 19270658 (-)
LOC110497471 LOC106609951 coding upstream 1148810 19303531 ~ 19310735 (-)
G1597647 NA non-coding downstream 1252 18152773 ~ 18153239 (-)
G1597639 NA non-coding downstream 9527 18144647 ~ 18144964 (-)
G1597632 NA non-coding downstream 16574 18137699 ~ 18137917 (-)
G1597629 NA non-coding downstream 18603 18135654 ~ 18135888 (-)
G1597610 NA non-coding downstream 36309 18117845 ~ 18118182 (-)
G1597833 NA non-coding upstream 152799 18307520 ~ 18307757 (-)
G1597842 NA non-coding upstream 160277 18314998 ~ 18315213 (-)
G1598084 NA non-coding upstream 247496 18402217 ~ 18408359 (-)
G1598114 NA non-coding upstream 301238 18455959 ~ 18456664 (-)
G1598115 NA non-coding upstream 303662 18458383 ~ 18458602 (-)
LOC110497446 NA other downstream 531015 17615897 ~ 17623476 (-)
G1596970 LOC106609899 other downstream 655048 17494669 ~ 17530745 (-)
G1596940 NA other downstream 716613 17437664 ~ 17437878 (-)
G1596879 NA other downstream 866474 17286530 ~ 17288017 (-)
G1596856 LOC106613263 other downstream 911468 17242606 ~ 17243023 (-)
G1598418 NA other upstream 608994 18763715 ~ 18764422 (-)
G1599097 LOC106609944 other upstream 1054571 19209292 ~ 19209964 (-)
G1599197 NA other upstream 1217588 19372309 ~ 19381751 (-)
G1599717 NA other upstream 1400876 19555597 ~ 19557357 (-)
G1599760 LOC106609957 other upstream 1481297 19636018 ~ 19637027 (-)

Expression


G1597650 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1597650 Expression in each Bioproject

Bar chart with 21 bars.
G1597650 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network