G1598960



Basic Information


Item Value
gene id G1598960
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 19331741 ~ 19332220 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1830796
acggcaatctgggaggcaagggctgagtgtactaaccagtatcaggactttaaggaggagatgatacaggtttttgatcgatctgtttttggggaggaggcttccagggccctgtcttccctatgtcaaggtaatcgatccataacagactactctattgagtttcgcactcttgctgcctccagtggctggaacgagccggctttgctcgctcgttttctggagggtctccgcgcagaggtaaaggatgagattctctcccgggaggttccttccagcgtggattccttgattgaactcgctattcgcattgagcgacgggttgatcttcgtcaccgagctcgtggaaaggagctcgcgttctccgttgcccccctctccgcatcactaccatcttcctctgccggctcgggtgctgagcctatgcagctgggaggtatccgcatctcgactaaggagagggaacggagaatcaccaac

Function


NR:

description
Retrotransposon-derived protein PEG10

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1830796 True 480 TUCP 0.54 1 19331741 19332220

Neighbor


gene id symbol gene type direction distance location
LOC110497472 LOC106609985 coding upstream 3392 19326377 ~ 19328349 (+)
LOC110497470 LOC106609950 coding upstream 28867 19293883 ~ 19302874 (+)
LOC110497468 glb1 coding upstream 105321 19221360 ~ 19226420 (+)
LOC110497465 LOC106609944 coding upstream 112912 19203079 ~ 19218829 (+)
LOC110497464 NA coding upstream 135164 19194817 ~ 19196577 (+)
LOC110497473 NA coding downstream 15683 19343155 ~ 19358450 (+)
LOC110497534 LOC106609954 coding downstream 252852 19585072 ~ 19591442 (+)
LOC110497532 LOC106609956 coding downstream 271528 19603748 ~ 19620028 (+)
LOC110497531 LOC106609957 coding downstream 294634 19626854 ~ 19642015 (+)
LOC118941465 LOC106609958 coding downstream 369597 19701817 ~ 19702322 (+)
G1598947 NA non-coding upstream 30183 19300889 ~ 19301558 (+)
G1598943 NA non-coding upstream 41915 19289527 ~ 19289826 (+)
G1598888 NA non-coding upstream 141588 19189881 ~ 19190153 (+)
G1598816 NA non-coding upstream 182968 19148406 ~ 19148773 (+)
G1598851 NA non-coding upstream 210388 19121129 ~ 19121353 (+)
G1598973 NA non-coding downstream 23507 19355727 ~ 19355999 (+)
G1599219 NA non-coding downstream 109175 19441395 ~ 19441739 (+)
G1599221 NA non-coding downstream 110110 19442330 ~ 19442912 (+)
G1599224 NA non-coding downstream 116208 19448428 ~ 19448641 (+)
G1598786 NA other upstream 298565 19032885 ~ 19033176 (+)
G1597342 LOC106609914 other upstream 1227149 18043411 ~ 18104592 (+)
G1597295 NA other upstream 1314701 18007723 ~ 18018250 (+)
pold4 pold4 other upstream 1708268 17621396 ~ 17623478 (+)
G1598961 LOC107681197 other downstream 800 19333020 ~ 19333450 (+)
G1599186 NA other downstream 60071 19392291 ~ 19418517 (+)
LOC110497530 cdk2ap2 other downstream 390835 19722973 ~ 19729929 (+)
G1599434 LOC106609964 other downstream 515662 19847882 ~ 19848518 (+)
LOC110497526 NA other downstream 533970 19866114 ~ 19874626 (+)

Expression


G1598960 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1598960 Expression in each Bioproject

Bar chart with 20 bars.
G1598960 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network