G1598961 (LOC107681197)



Basic Information


Item Value
gene id G1598961
gene name LOC107681197
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 19333020 ~ 19333450 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1830797
gttttttttgttaagaagaaggacgggtccctgcgcccctgcatagattatcgagggctgaatgacataacagtgaagaatcgttatccgcttcctcttatgtcttcagccttcgagatcctgcagggagccaggtttttcactaagttggaccttcgtaacgcttaccatctcgtgcgcatcagggagggggacgagtggaagacggcgtttaacactccgttagggcactttgaataccgggttcttcctttcggcctcgctaacgctccagctgtctttcaggcattagtcaatgatgtcctgagagacatgctgaacatctttgttttcgtttaccttgacgatatcctgattttttcactgtcactccagattcatgttcagcacgttcgacgtgtcctccagcgccttttagagaattgtctttt

Function


NR:

description
PREDICTED: uncharacterized protein LOC109045530

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1830797 True 431 TUCP 0.48 1 19333020 19333450
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110497472 LOC106609985 coding upstream 4671 19326377 ~ 19328349 (+)
LOC110497470 LOC106609950 coding upstream 30146 19293883 ~ 19302874 (+)
LOC110497468 glb1 coding upstream 106600 19221360 ~ 19226420 (+)
LOC110497465 LOC106609944 coding upstream 114191 19203079 ~ 19218829 (+)
LOC110497464 NA coding upstream 136443 19194817 ~ 19196577 (+)
LOC110497473 NA coding downstream 14453 19343155 ~ 19358450 (+)
LOC110497534 LOC106609954 coding downstream 251622 19585072 ~ 19591442 (+)
LOC110497532 LOC106609956 coding downstream 270298 19603748 ~ 19620028 (+)
LOC110497531 LOC106609957 coding downstream 293404 19626854 ~ 19642015 (+)
LOC118941465 LOC106609958 coding downstream 368367 19701817 ~ 19702322 (+)
G1598947 NA non-coding upstream 31462 19300889 ~ 19301558 (+)
G1598943 NA non-coding upstream 43194 19289527 ~ 19289826 (+)
G1598888 NA non-coding upstream 142867 19189881 ~ 19190153 (+)
G1598816 NA non-coding upstream 184247 19148406 ~ 19148773 (+)
G1598851 NA non-coding upstream 211667 19121129 ~ 19121353 (+)
G1598973 NA non-coding downstream 22277 19355727 ~ 19355999 (+)
G1599219 NA non-coding downstream 107945 19441395 ~ 19441739 (+)
G1599221 NA non-coding downstream 108880 19442330 ~ 19442912 (+)
G1599224 NA non-coding downstream 114978 19448428 ~ 19448641 (+)
G1598960 NA other upstream 800 19331741 ~ 19332220 (+)
G1598786 NA other upstream 299844 19032885 ~ 19033176 (+)
G1597342 LOC106609914 other upstream 1228428 18043411 ~ 18104592 (+)
G1597295 NA other upstream 1315980 18007723 ~ 18018250 (+)
G1599186 NA other downstream 58841 19392291 ~ 19418517 (+)
LOC110497530 cdk2ap2 other downstream 389605 19722973 ~ 19729929 (+)
G1599434 LOC106609964 other downstream 514432 19847882 ~ 19848518 (+)
LOC110497526 NA other downstream 532740 19866114 ~ 19874626 (+)
LOC110497521 LOC106602766 other downstream 711142 20039547 ~ 20046898 (+)

Expression


G1598961(LOC107681197) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1598961(LOC107681197) Expression in each Bioproject

Bar chart with 20 bars.
G1598961(LOC107681197) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network