G1599434 (LOC106609964)



Basic Information


Item Value
gene id G1599434
gene name LOC106609964
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 19847882 ~ 19848518 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1831349
GTTTTATGTGCAAATGTGTGCGTGCTGGCCTAGGTGCTTGTATCGGGTGCCACTGTGCCTACCCTTTCTGAGCGTCGTTGATGCACATCCCAAACTGGCTCGTGCCGGCCTCCATGCAGCGGCGGATCATGAGACGGTAGCGCGGTTCGAAGACGTGCAGGGGACACGGCACGGTCGGGTAGGCCATGGTGCACACAAAGATGGGCACCTTCTTCATCAGGTCTGCGAGCTCTTGGGTCTCCTCCAGGTGAGTCTTCTGCCGTTCCGACTGCTCCTTAGACAGGTACTGCTTTATCACTCGGTCCAG

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1831349 True 307 TUCP 0.58 2 19847882 19848518

Neighbor


gene id symbol gene type direction distance location
LOC110498681 LOC106609965 coding upstream 6998 19814047 ~ 19840884 (+)
serping1 LOC100136072 coding upstream 96554 19745460 ~ 19751328 (+)
LOC110497530 cdk2ap2 coding upstream 117953 19722973 ~ 19729929 (+)
LOC110498684 LOC106609958 coding upstream 140567 19702703 ~ 19707315 (+)
LOC118941465 LOC106609958 coding upstream 145560 19701817 ~ 19702322 (+)
LOC110497526 NA coding downstream 17596 19866114 ~ 19874626 (+)
LOC110497524 LOC106609967 coding downstream 30102 19878620 ~ 19903005 (+)
LOC110497523 LOC106609968 coding downstream 80690 19929208 ~ 19947523 (+)
LOC110498679 LOC106602767 coding downstream 112148 19960666 ~ 19986083 (+)
trnar-ucu-7 NA coding downstream 147142 19995660 ~ 19995751 (+)
G1599414 NA non-coding upstream 4352 19841440 ~ 19843530 (+)
G1599328 NA non-coding upstream 183751 19663885 ~ 19664131 (+)
LOC110497531 LOC106609957 non-coding upstream 205884 19626854 ~ 19642015 (+)
G1599321 NA non-coding upstream 214950 19632548 ~ 19632932 (+)
G1599421 LOC106609964 non-coding downstream 1626 19850144 ~ 19851166 (+)
G1599487 NA non-coding downstream 137986 19986504 ~ 19989016 (+)
G1599491 NA non-coding downstream 142735 19991253 ~ 19991475 (+)
G1599493 NA non-coding downstream 144271 19992789 ~ 19993074 (+)
G1599186 NA other upstream 429365 19392291 ~ 19418517 (+)
G1598961 LOC107681197 other upstream 514432 19333020 ~ 19333450 (+)
G1598960 NA other upstream 515662 19331741 ~ 19332220 (+)
LOC110497472 LOC106609985 other upstream 519553 19326377 ~ 19328349 (+)
LOC110497521 LOC106602766 other downstream 196074 20039547 ~ 20046898 (+)
G1600166 NA other downstream 562155 20410673 ~ 20410899 (+)
G1600167 NA other downstream 562515 20411033 ~ 20411311 (+)
G1600174 adra1b other downstream 570128 20418646 ~ 20420655 (+)

Expression


G1599434(LOC106609964) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1599434(LOC106609964) Expression in each Bioproject

Bar chart with 12 bars.
G1599434(LOC106609964) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network