G1622772



Basic Information


Item Value
gene id G1622772
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 38927707 ~ 38928311 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1856873
tgtttcgattgggttcaaatctgggctctggctgggccactcaaggacattcagagacttgtcccgaagcaactcctgcgttgtcttggctgtgtgcttagggtcgttgtcctgttggaaggggaaccttcaccccagtctgaggtcctgagcactctgaaacaggttatcatcaaggacctctctctactttgctccgttcatctttgcctcgaccctgactactctcacagtccctgccactgaaaaacatccccacagcatgacgctgccaccaccatgcttcaccgtagggatggtatcaggtttcctccagatgtgacgcttggcattcaggccaaagagttcaatcttggtttcatcagaccagagaatcttgtttctcatggtctgagagtgttttaggtgaattttggcaaacttcaagcgggctgtcatgtgccttttactgaggagtggcttctgtctgggccactctactacaaatgcctgattggtgaagtgctgcagagatggttgtctttctggaagtttctcccatctccacagaagaactctggagctctgtcagagtggccatcaggttcttggtcacctccaggacc

Function


NR:

description
TC1-like transposase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1856873 True 605 lncRNA 0.51 1 38927707 38928311
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110497791 LOC106600514 coding downstream 796 38911281 ~ 38926911 (-)
LOC110497790 gnpi coding downstream 28886 38892389 ~ 38898821 (-)
LOC110497787 LOC106600539 coding downstream 165547 38709218 ~ 38762160 (-)
LOC110497783 LOC106600563 coding downstream 253460 38654186 ~ 38674247 (-)
dapp1 dapp1 coding downstream 273674 38645382 ~ 38654033 (-)
lrit3b LOC106600744 coding upstream 7104 38935354 ~ 38939611 (-)
ampm1 ampm1 coding upstream 57486 38985797 ~ 38988755 (-)
enpp4 enpp4 coding upstream 296379 39224690 ~ 39231092 (-)
cdc5l LOC106599718 coding upstream 313887 39242198 ~ 39263880 (-)
LOC110498575 LOC106599699 coding upstream 347932 39276243 ~ 39278434 (-)
G1622771 NA non-coding downstream 84 38927407 ~ 38927623 (-)
G1622764 NA non-coding downstream 16481 38910945 ~ 38911226 (-)
G1622763 NA non-coding downstream 17137 38910282 ~ 38910570 (-)
G1622673 LOC106600519 non-coding downstream 77367 38846752 ~ 38850340 (-)
G1622712 LOC106600528 non-coding downstream 97317 38827895 ~ 38830390 (-)
G1622775 NA non-coding upstream 2990 38931301 ~ 38932352 (-)
G1622784 NA non-coding upstream 75519 39003830 ~ 39005396 (-)
G1622892 NA non-coding upstream 243397 39171708 ~ 39171949 (-)
G1622914 LOC100380701 non-coding upstream 267176 39195487 ~ 39196095 (-)
LOC110497753 spred1 other downstream 2159008 36654523 ~ 36840800 (-)
G1619119 NA other downstream 2522371 36401554 ~ 36405336 (-)
LOC110498336 LOC106611177 other downstream 3530924 35392412 ~ 35396783 (-)
G1615810 hectd1 other downstream 5448271 33478593 ~ 33479436 (-)
G1615793 NA other downstream 5514490 33412219 ~ 33413217 (-)
G1622757 LOC106600509 other upstream 28713 38957024 ~ 38958974 (-)
si:dkey-229e3.2 LOC106599591 other upstream 436946 39365257 ~ 39370631 (-)
G1623037 LOC106586451 other upstream 467757 39396068 ~ 39411784 (-)
G1623175 NA other upstream 747128 39675439 ~ 39681529 (-)
LOC110497838 trmt5 other upstream 1539033 40467344 ~ 40547622 (-)

Expression


G1622772 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1622772 Expression in each Bioproject

Bar chart with 21 bars.
G1622772 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network