G1622914 (LOC100380701)



Basic Information


Item Value
gene id G1622914
gene name LOC100380701
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 39195487 ~ 39196095 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1857042
CAATATCTTCTGAGCCTCGGTCCAAAAGGCTATGTTGGGCTCCTCCAGGTGGAATAGGGCCCAGGACTTGGAGCGGAAGTTGGGCCCATGGAAGCAGGCCAGGGTCATGTGGTTGCCATGGAGACTCATGGAGCCACCCAGTTGCACGGCGTCCTCTGGGAGAGGCATCTGGAAGAGGGAGATGTGGCATCCAGCGATCACCTTCAGAACCCCAGGCCAGTGACGATGGTGGGCTGCATCCATGTATAGCTCTGCAGCTTCTTTCTCGATGTTGATGACCGGCGCCTTCGGGGGCAGGTAGGGAACTGGACCCCATGTGGACAACGCTCGTTTGCTGGTGTCAAATTGCTGGGTAAAAAACTCCTGCAGCTTCATCCCGATCTTAATGAGGTCGGGGGTAGTGGAGCGCGAGATGATCACTTGGAAGATATCCCACTGCAAGTCACCGTGGACAAAGATC

Function


NR:

description
uncharacterized protein KIAA1109-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1857042 True 460 lncRNA 0.56 2 39195487 39196095
Loading

Neighbor


gene id symbol gene type direction distance location
ampm1 ampm1 coding downstream 206732 38985797 ~ 38988755 (-)
lrit3b LOC106600744 coding downstream 255876 38935354 ~ 38939611 (-)
LOC110497791 LOC106600514 coding downstream 268576 38911281 ~ 38926911 (-)
LOC110497790 gnpi coding downstream 296666 38892389 ~ 38898821 (-)
LOC110497787 LOC106600539 coding downstream 433327 38709218 ~ 38762160 (-)
enpp4 enpp4 coding upstream 28595 39224690 ~ 39231092 (-)
cdc5l LOC106599718 coding upstream 46103 39242198 ~ 39263880 (-)
LOC110498575 LOC106599699 coding upstream 80148 39276243 ~ 39278434 (-)
LOC110497802 LOC105031663 coding upstream 82601 39278696 ~ 39285767 (-)
si:dkey-229e3.2 LOC106599591 coding upstream 169163 39365257 ~ 39370631 (-)
G1622892 NA non-coding downstream 23538 39171708 ~ 39171949 (-)
G1622784 NA non-coding downstream 190091 39003830 ~ 39005396 (-)
G1622775 NA non-coding downstream 263135 38931301 ~ 38932352 (-)
G1622772 NA non-coding downstream 267176 38927707 ~ 38928311 (-)
G1622918 LOC106599729 non-coding upstream 9202 39205297 ~ 39207491 (-)
G1622936 NA non-coding upstream 24588 39220683 ~ 39220918 (-)
G1622987 NA non-coding upstream 130194 39326289 ~ 39326730 (-)
G1623038 LOC106586451 non-coding upstream 204145 39400240 ~ 39404651 (-)
G1622757 LOC106600509 other downstream 236513 38957024 ~ 38958974 (-)
LOC110497753 spred1 other downstream 2426788 36654523 ~ 36840800 (-)
G1619119 NA other downstream 2790151 36401554 ~ 36405336 (-)
LOC110498336 LOC106611177 other downstream 3798704 35392412 ~ 35396783 (-)
G1615810 hectd1 other downstream 5716051 33478593 ~ 33479436 (-)
G1623037 LOC106586451 other upstream 199973 39396068 ~ 39411784 (-)
G1623175 NA other upstream 479344 39675439 ~ 39681529 (-)
LOC110497838 trmt5 other upstream 1271249 40467344 ~ 40547622 (-)
G1624738 NA other upstream 1433670 40629765 ~ 40630208 (-)

Expression


G1622914(LOC100380701) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1622914(LOC100380701) Expression in each Bioproject

Bar chart with 10 bars.
G1622914(LOC100380701) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network