G1623427



Basic Information


Item Value
gene id G1623427
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 40163643 ~ 40163854 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1857703
acattccatgcgactttagaaaaaaacatgcagggcttcaaatcaaatcaaactttattggtcacttacacatggttagcagatgttcatgcgagtgtagcgaaatgcttgtgcttctagttccgaccatgcagtaatatctacaagtaatctaacctaacaatttcacagcgactaccttttacacacaagtgtaaaggaatgaataagaa

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1857703 True 212 lncRNA 0.37 1 40163643 40163854

Neighbor


gene id symbol gene type direction distance location
syne2b LOC106599102 coding downstream 65664 39955126 ~ 40097979 (-)
LOC110497823 LOC106599217 coding downstream 470825 39689558 ~ 39692818 (-)
LOC110497819 bag5 coding downstream 557800 39590341 ~ 39605843 (-)
ckba ckb coding downstream 602443 39550499 ~ 39561200 (-)
si:dkey-196h17.9 LOC106586342 coding downstream 660343 39498620 ~ 39503300 (-)
LOC110497830 LOC106599033 coding upstream 37902 40201756 ~ 40235731 (-)
LOC118941474 NA coding upstream 62111 40225965 ~ 40229000 (-)
LOC110497831 sgpp1 coding upstream 130713 40294567 ~ 40312562 (-)
LOC110497832 NA coding upstream 149122 40312976 ~ 40316713 (-)
syt16 syt16 coding upstream 153450 40317304 ~ 40341212 (-)
G1623424 NA non-coding downstream 3816 40159406 ~ 40159827 (-)
G1623422 NA non-coding downstream 7415 40155989 ~ 40156228 (-)
G1623420 NA non-coding downstream 8741 40154646 ~ 40154902 (-)
G1623418 NA non-coding downstream 10666 40152697 ~ 40152977 (-)
G1623414 NA non-coding downstream 12838 40150596 ~ 40150805 (-)
G1623431 NA non-coding upstream 9827 40173681 ~ 40173957 (-)
G1623434 NA non-coding upstream 12891 40176745 ~ 40177093 (-)
G1623440 NA non-coding upstream 21144 40184998 ~ 40185222 (-)
G1623442 NA non-coding upstream 25119 40188973 ~ 40189254 (-)
G1623454 NA non-coding upstream 33782 40197636 ~ 40199429 (-)
G1623175 NA other downstream 482114 39675439 ~ 39681529 (-)
G1623037 LOC106586451 other downstream 751859 39396068 ~ 39411784 (-)
si:dkey-229e3.2 LOC106599591 other downstream 793377 39365257 ~ 39370631 (-)
G1622757 LOC106600509 other downstream 1204669 38957024 ~ 38958974 (-)
LOC110497753 spred1 other downstream 3394944 36654523 ~ 36840800 (-)
LOC110497838 trmt5 other upstream 303490 40467344 ~ 40547622 (-)
G1624738 NA other upstream 465911 40629765 ~ 40630208 (-)
G1624737 NA other upstream 466724 40630578 ~ 40631738 (-)
LOC110498350 NA other upstream 531621 40689096 ~ 40699267 (-)
LOC110497863 LOC106596965 other upstream 905909 41052866 ~ 41080347 (-)

Expression



Co-expression Network