G1623533



Basic Information


Item Value
gene id G1623533
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 40266952 ~ 40267223 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1857812
cctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgcggcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttca

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1857812 True 272 lncRNA 0.38 1 40266952 40267223

Neighbor


gene id symbol gene type direction distance location
LOC110497830 LOC106599033 coding downstream 31221 40201756 ~ 40235731 (-)
LOC118941474 NA coding downstream 37952 40225965 ~ 40229000 (-)
kcnh5b LOC106599078 coding downstream 72684 40111716 ~ 40194268 (-)
syne2b LOC106599102 coding downstream 168973 39955126 ~ 40097979 (-)
LOC110497823 LOC106599217 coding downstream 574134 39689558 ~ 39692818 (-)
LOC110497831 sgpp1 coding upstream 27344 40294567 ~ 40312562 (-)
LOC110497832 NA coding upstream 45753 40312976 ~ 40316713 (-)
syt16 syt16 coding upstream 50081 40317304 ~ 40341212 (-)
snapc1b LOC106598946 coding upstream 75133 40342356 ~ 40349828 (-)
hif1a hif-1a coding upstream 86653 40353876 ~ 40375782 (-)
G1623454 NA non-coding downstream 67523 40197636 ~ 40199429 (-)
G1623442 NA non-coding downstream 77698 40188973 ~ 40189254 (-)
G1623440 NA non-coding downstream 81730 40184998 ~ 40185222 (-)
G1623434 NA non-coding downstream 89859 40176745 ~ 40177093 (-)
G1623431 NA non-coding downstream 92995 40173681 ~ 40173957 (-)
G1623534 NA non-coding upstream 816 40268039 ~ 40268290 (-)
G1623540 NA non-coding upstream 3128 40270351 ~ 40270632 (-)
G1623572 NA non-coding upstream 15716 40282939 ~ 40283952 (-)
G1624649 NA non-coding upstream 122105 40389328 ~ 40390006 (-)
G1623175 NA other downstream 585423 39675439 ~ 39681529 (-)
G1623037 LOC106586451 other downstream 855168 39396068 ~ 39411784 (-)
si:dkey-229e3.2 LOC106599591 other downstream 896686 39365257 ~ 39370631 (-)
G1622757 LOC106600509 other downstream 1307978 38957024 ~ 38958974 (-)
LOC110497753 spred1 other downstream 3498253 36654523 ~ 36840800 (-)
LOC110497838 trmt5 other upstream 200121 40467344 ~ 40547622 (-)
G1624738 NA other upstream 362542 40629765 ~ 40630208 (-)
G1624737 NA other upstream 363355 40630578 ~ 40631738 (-)
LOC110498350 NA other upstream 428252 40689096 ~ 40699267 (-)
LOC110497863 LOC106596965 other upstream 802540 41052866 ~ 41080347 (-)

Expression


G1623533 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1623533 Expression in each Bioproject

Bar chart with 16 bars.
G1623533 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network