G1623537 (LOC106613263)



Basic Information


Item Value
gene id G1623537
gene name LOC106613263
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 40269853 ~ 40270067 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1857816
gttctccacggcgtctccagactgtcacgtctgtcacatgtgctcagtgtgaacctgttttcatctgtgaagagcacagggcgccagtggcgaatttgccaatcttggtgttctctgacaaatgccaaacgtcctgcacggtgttgggctgtaagcacaacccccacctgtggacgtcgggccctcataccaccctcatggagtctgtttctgac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1857816 True 215 lncRNA 0.55 1 40269853 40270067
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498349 gphb5 coding upstream 167462 40099735 ~ 40102391 (+)
erb2 erb2 coding upstream 313548 39919737 ~ 39956305 (+)
LOC110497825 LOC106599208 coding upstream 423611 39820210 ~ 39846242 (+)
LOC118941473 NA coding upstream 478819 39786957 ~ 39791034 (+)
LOC110497824 LOC106610962 coding upstream 539693 39674038 ~ 39730168 (+)
LOC110497836 trmt5 coding downstream 195840 40465907 ~ 40468723 (+)
LOC110497840 LOC106598809 coding downstream 274849 40544916 ~ 40553190 (+)
LOC110497841 LOC106598867 coding downstream 289212 40559279 ~ 40562442 (+)
LOC110497848 rtn1 coding downstream 437534 40707601 ~ 40757224 (+)
LOC110497851 rd3l coding downstream 511866 40781933 ~ 40785680 (+)
G1623523 NA non-coding upstream 10704 40258885 ~ 40259149 (+)
G1622547 NA non-coding upstream 77065 40192575 ~ 40192788 (+)
G1622531 NA non-coding upstream 96891 40172744 ~ 40172962 (+)
G1622530 NA non-coding upstream 100086 40169527 ~ 40169767 (+)
G1622527 NA non-coding upstream 103193 40166399 ~ 40166660 (+)
G1623539 NA non-coding downstream 119 40270186 ~ 40270584 (+)
G1623544 NA non-coding downstream 3468 40273535 ~ 40273764 (+)
G1623561 NA non-coding downstream 11320 40281387 ~ 40281634 (+)
G1623575 NA non-coding downstream 22036 40292103 ~ 40292379 (+)
G1623579 NA non-coding downstream 47258 40317325 ~ 40362584 (+)
G1622452 LOC106599102 other upstream 207512 40051939 ~ 40062341 (+)
G1622047 LOC106599718 other upstream 1005963 39242203 ~ 39263890 (+)
G1621935 NA other upstream 1249325 38992643 ~ 39020528 (+)
G1621909 NA other upstream 1340670 38928586 ~ 38929183 (+)
commd8 LOC106600549 other upstream 1566338 38686057 ~ 38703559 (+)
plk4 LOC106597351 other downstream 714030 40984051 ~ 40993783 (+)
G1624239 NA other downstream 1174454 41444521 ~ 41446361 (+)
G1624560 NA other downstream 1739894 42009961 ~ 42010330 (+)
tmem260 LOC106593970 other downstream 1754541 41988770 ~ 42029506 (+)
G1624565 LOC100846954 other downstream 1765286 42035353 ~ 42035944 (+)

Expression


G1623537(LOC106613263) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1623537(LOC106613263) Expression in each Bioproject

Bar chart with 17 bars.
G1623537(LOC106613263) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network