G1623544



Basic Information


Item Value
gene id G1623544
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 40273535 ~ 40273764 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1857823
CCCCACTCAACACACACGCCCTCTTACTAGGGGATGGTTTGGTTCCATCGTTGATACCTATTGGCCAACCTGGTTTTGTTTCGTTGATTTGGTTGGTTGTCCTTAACAATGCTTGAATCCTCCGAAACCAGCGACATGTTTCTTTGAGTTCGTAAGTATCTCTCGTCAATGAATCGTTCAAGCTCTTCAATGGATTCTGAATCATCCAGCAGAGTTAAGCACACAAACAA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1857823 True 230 lncRNA 0.44 1 40273535 40273764
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498349 gphb5 coding upstream 171144 40099735 ~ 40102391 (+)
erb2 erb2 coding upstream 317230 39919737 ~ 39956305 (+)
LOC110497825 LOC106599208 coding upstream 427293 39820210 ~ 39846242 (+)
LOC118941473 NA coding upstream 482501 39786957 ~ 39791034 (+)
LOC110497824 LOC106610962 coding upstream 543375 39674038 ~ 39730168 (+)
LOC110497836 trmt5 coding downstream 192143 40465907 ~ 40468723 (+)
LOC110497840 LOC106598809 coding downstream 271152 40544916 ~ 40553190 (+)
LOC110497841 LOC106598867 coding downstream 285515 40559279 ~ 40562442 (+)
LOC110497848 rtn1 coding downstream 433837 40707601 ~ 40757224 (+)
LOC110497851 rd3l coding downstream 508169 40781933 ~ 40785680 (+)
G1623539 NA non-coding upstream 2951 40270186 ~ 40270584 (+)
G1623537 LOC106613263 non-coding upstream 3468 40269853 ~ 40270067 (+)
G1623523 NA non-coding upstream 14386 40258885 ~ 40259149 (+)
G1622547 NA non-coding upstream 80747 40192575 ~ 40192788 (+)
G1622531 NA non-coding upstream 100573 40172744 ~ 40172962 (+)
G1623561 NA non-coding downstream 7623 40281387 ~ 40281634 (+)
G1623575 NA non-coding downstream 18339 40292103 ~ 40292379 (+)
G1623579 NA non-coding downstream 43561 40317325 ~ 40362584 (+)
G1623578 hif-1a non-coding downstream 80118 40353882 ~ 40356016 (+)
G1623624 NA non-coding downstream 118836 40392600 ~ 40396042 (+)
G1622452 LOC106599102 other upstream 211194 40051939 ~ 40062341 (+)
G1622047 LOC106599718 other upstream 1009645 39242203 ~ 39263890 (+)
G1621935 NA other upstream 1253007 38992643 ~ 39020528 (+)
G1621909 NA other upstream 1344352 38928586 ~ 38929183 (+)
commd8 LOC106600549 other upstream 1570020 38686057 ~ 38703559 (+)
plk4 LOC106597351 other downstream 710333 40984051 ~ 40993783 (+)
G1624239 NA other downstream 1170757 41444521 ~ 41446361 (+)
G1624560 NA other downstream 1736197 42009961 ~ 42010330 (+)
tmem260 LOC106593970 other downstream 1750844 41988770 ~ 42029506 (+)
G1624565 LOC100846954 other downstream 1761589 42035353 ~ 42035944 (+)

Expression


G1623544 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1623544 Expression in each Bioproject

Bar chart with 13 bars.
G1623544 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network