G1625710


Basic Information

Item Value
gene id G1625710
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 42250731 ~ 42251571 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1860306
actgtgcagtaccgaagagcccttactgctgctcgatcatcctatttttccaacataattgttgaaaataagaacaatccgaaattcctttttgatactgtcgcaaagctaactaaaaagcagcattccccaagagaggatgactttcactttagcagtgataaattcatgaacttctttgaggaaaagattatgattattagaaagcaaattacggactcttccttaaatctgcgtattccttcaaagctcagttgtcctgagtctgcacaactctgccaggacctaggatcaagagagacactcaagtgttttagtactatatctcttgacacaatgatgaaaataatcatggcctctaaaccttcaagctgcatactggaccctattccaactaaactcctgaaagagctgcttcctgtgcttggccctactatgttgaacataataaacggctctctatccaccggatgtgtaccaaactcactaaaagtggcagtaataaagcctctcttgaaaaagccaaaccttgacccagaaaatataaaaaactatcggcctatattgaatcttccattcctctcaaaaattttagaaaaggctgttgcgcaacaactcactgccttcctgaagacaaacaatgtatacgaaatgcttcagtctggttttagaccccatcatagcactgagacggcacttgtgaaggtggtaaatgacattttaatggcatcggaccgaggctctgcatctgtcctcgtgctcctagaccttagtgctgcttttgataccatcgatcaccacattcttttggagagattggaaacccaaattggtctacacg

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1860306 True 841 TUCP 0.41 1 42250731 42251571

Neighbor

gene id symbol gene type direction distance location
LOC110497895 NA coding upstream 20253 42228256 ~ 42230812 (+)
LOC110497893 NA coding upstream 88444 42158731 ~ 42162287 (+)
tmem260 LOC106593970 coding upstream 221280 41988770 ~ 42029506 (+)
LOC110497886 LOC106594164 coding upstream 266640 41941804 ~ 41984091 (+)
LOC100305273 ktn1 coding upstream 313973 41892564 ~ 41936758 (+)
LOC110497896 LOC106593515 coding downstream 25407 42276978 ~ 42300523 (+)
LOC110497898 tmem63c coding downstream 89396 42340967 ~ 42375186 (+)
LOC110497900 NA coding downstream 137305 42388876 ~ 42398844 (+)
LOC110497904 bbof1 coding downstream 170182 42421753 ~ 42431912 (+)
gstz1 gstz1 coding downstream 192868 42444439 ~ 42448291 (+)
G1625702 NA non-coding upstream 5352 42245118 ~ 42245379 (+)
G1625699 NA non-coding upstream 11622 42238827 ~ 42239109 (+)
G1625677 NA non-coding upstream 42824 42206985 ~ 42207907 (+)
G1625640 LOC106593771 non-coding upstream 101013 42148917 ~ 42149718 (+)
G1625713 NA non-coding downstream 3810 42255381 ~ 42255642 (+)
G1625714 NA non-coding downstream 4208 42255779 ~ 42256037 (+)
G1625718 NA non-coding downstream 15183 42266754 ~ 42266958 (+)
G1625761 NA non-coding downstream 85927 42337498 ~ 42337713 (+)
G1624524 NA other upstream 213613 42036328 ~ 42037118 (+)
G1624565 LOC100846954 other upstream 214787 42035353 ~ 42035944 (+)
G1624560 NA other upstream 240401 42009961 ~ 42010330 (+)
G1624239 NA other upstream 804370 41444521 ~ 41446361 (+)
LOC110497931 LOC106589425 other downstream 1060269 43279273 ~ 43440028 (+)
G1627319 NA other downstream 1563155 43814593 ~ 43816501 (+)
G1628073 LOC106610840 other downstream 2162751 44414322 ~ 44448672 (+)
G1628486 NA other downstream 2431791 44683362 ~ 44748925 (+)
G1628488 NA other downstream 2436811 44688382 ~ 44747446 (+)

Expression

G1625710 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1625710 Expression in each Bioproject

Bar chart with 20 bars.
G1625710 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network