G1626232 (LOC106611303)



Basic Information


Item Value
gene id G1626232
gene name LOC106611303
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 42640449 ~ 42641273 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1860906
tggcccgtgggccaaatttggcccgcggggtaattatatttggcccgcgagacaataccaaattactactagagctggcccgccggtattatacagcgcattcaccactaatactacgaatcccataatgctctgctgtttttgcgcgccaatcaggacaggacccagaaatgctctctcctctgtgacagtagtcatagcaacatagacgctacaactgtcagcgagctaacccttcccaaaaatggcgaaaagaaaggcagaaaacaggagctttctggacaagtgggaggcagaatatctgtttacatatgtaaaagacaaacctgtttgtcttgtttgtggattcaacgtggctgtaagtaaggagtacaacattagacgacactatgaaacgaaacaccatgacaaatacaaggacctggacatgactcaaaggagccagaaagtagaggagatgaaaagaagtttggtttcacaacagaatatgtttaaaaaagccacatcacaaagcgaggatcacagacatgtacgctgcagtgagggccttcaaaactaaactgtgcctgtgggagaatcagatgctgcaagaaaacccttgccattttccctgctgccaatccataaaagcgcagatctctaccgccgtgttcccatgcgcacagtttgctgaaaaactcaatgttctcgccgctgagtttagccggcgatttgccgacttcgatgcccagaaatgcaagtttgaactgcttagtaatcccttcgcagttgatgtggaaaatgcaccaaccaacatccaaatggagctgattgaactccagtgca

Function


NR:

description
general transcription factor II-I repeat domain-containing protein 2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1860906 True 825 TUCP 0.46 1 42640449 42641273

Neighbor


gene id symbol gene type direction distance location
LOC110497915 LOC106591465 coding downstream 35685 42601758 ~ 42604764 (-)
LOC110497913 NA coding downstream 68992 42570828 ~ 42571457 (-)
eml5 LOC106591625 coding downstream 78480 42494458 ~ 42561969 (-)
npc2 npc2 coding downstream 148387 42489857 ~ 42492062 (-)
LOC110498355 atg2b coding downstream 159575 42465705 ~ 42480874 (-)
erg28 LOC106591002 coding upstream 27763 42669036 ~ 42671081 (-)
tgfb3 LOC106590795 coding upstream 123604 42764877 ~ 42786064 (-)
LOC110498358 LOC106590063 coding upstream 458952 43100225 ~ 43110498 (-)
LOC110497926 LOC106589845 coding upstream 484161 43125434 ~ 43135492 (-)
LOC110498359 LOC106599825 coding upstream 494927 43136200 ~ 43139430 (-)
G1626267 NA non-coding downstream 49138 42590982 ~ 42591311 (-)
G1626231 NA non-coding downstream 51581 42586935 ~ 42588868 (-)
G1626254 NA non-coding downstream 75047 42564355 ~ 42565402 (-)
G1626212 NA non-coding downstream 153475 42486722 ~ 42486974 (-)
G1626288 NA non-coding upstream 6316 42647589 ~ 42647792 (-)
G1626291 NA non-coding upstream 8857 42650130 ~ 42650687 (-)
G1626294 NA non-coding upstream 13236 42654509 ~ 42655253 (-)
G1626296 NA non-coding upstream 15082 42656355 ~ 42657840 (-)
G1626297 NA non-coding upstream 16635 42657908 ~ 42664575 (-)
G1626105 NA other downstream 384652 42255235 ~ 42255797 (-)
G1625428 arf6 other downstream 790016 41846255 ~ 41850433 (-)
G1625066 NA other downstream 1445690 41194433 ~ 41194759 (-)
LOC110497865 LOC106611002 other downstream 1478037 41144107 ~ 41162883 (-)
G1626324 NA other upstream 118021 42759294 ~ 42838434 (-)
G1627068 NA other upstream 767454 43408727 ~ 43409109 (-)
LOC110498001 NA other upstream 3362492 46003765 ~ 46008718 (-)
G1631005 NA other upstream 3977934 46619207 ~ 46629506 (-)
G1631120 LOC106612182 other upstream 4189061 46830334 ~ 46830650 (-)

Expression


G1626232(LOC106611303) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1626232(LOC106611303) Expression in each Bioproject

Bar chart with 20 bars.
G1626232(LOC106611303) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network