G1629175



Basic Information


Item Value
gene id G1629175
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 45467960 ~ 45468214 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1864124
gatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatatttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgtgcttttgacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1864124 True 255 lncRNA 0.42 1 45467960 45468214
Loading

Neighbor


gene id symbol gene type direction distance location
bub1bb LOC106582108 coding upstream 37753 45427075 ~ 45430207 (+)
zgc:162989 pp14b coding upstream 46046 45404636 ~ 45421914 (+)
LOC110497977 LOC106582390 coding upstream 166536 45298446 ~ 45301424 (+)
LOC110497973 LOC106583826 coding upstream 171585 45291705 ~ 45296375 (+)
LOC110497972 LOC106582486 coding upstream 176302 45266098 ~ 45291658 (+)
si:dkey-248g15.3 NA coding downstream 165420 45633634 ~ 45635163 (+)
LOC110497986 LOC106581668 coding downstream 194928 45663142 ~ 45672367 (+)
LOC110497988 LOC106581430 coding downstream 216644 45684858 ~ 45720183 (+)
LOC110497992 LOC106581094 coding downstream 325676 45793890 ~ 45798812 (+)
LOC110497991 LOC106580844 coding downstream 347759 45815973 ~ 45862580 (+)
G1629174 NA non-coding upstream 1899 45465807 ~ 45466061 (+)
G1629173 NA non-coding upstream 3657 45464093 ~ 45464303 (+)
G1629170 NA non-coding upstream 5903 45461829 ~ 45462057 (+)
G1629167 NA non-coding upstream 8645 45459100 ~ 45459315 (+)
G1629166 NA non-coding upstream 9103 45458625 ~ 45458857 (+)
LOC110497981 LOC106581963 non-coding downstream 1439 45444826 ~ 45470840 (+)
G1629181 NA non-coding downstream 9194 45477408 ~ 45477781 (+)
G1629182 NA non-coding downstream 10291 45478505 ~ 45478812 (+)
G1629183 NA non-coding downstream 10928 45479142 ~ 45479452 (+)
G1629193 NA non-coding downstream 24360 45492574 ~ 45492839 (+)
G1629134 spit1 other upstream 68138 45396831 ~ 45399822 (+)
G1628865 LOC105030512 other upstream 273719 45186962 ~ 45194241 (+)
LOC110497964 LOC106583112 other upstream 414409 45051160 ~ 45053552 (+)
G1628689 NA other upstream 580787 44886871 ~ 44887173 (+)
G1629200 NA other downstream 33580 45501794 ~ 45502263 (+)
G1629210 NA other downstream 47960 45516174 ~ 45516648 (+)
G1629779 LOC106580335 other downstream 545510 46013724 ~ 46016639 (+)
G1629912 NA other downstream 757168 46225382 ~ 46225820 (+)
LOC110498004 LOC106580093 other downstream 789705 46257919 ~ 46318609 (+)

Expression


G1629175 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1629175 Expression in each Bioproject

Bar chart with 18 bars.
G1629175 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network