G1630677



Basic Information


Item Value
gene id G1630677
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 46011289 ~ 46011556 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1865795
ctcaatcctgactagtctcccagtccctgaaaaacctccccacagaatgattctgccaccactacgcttcactgtagggatggtgccaggtttcctccagatgtgacgcttggcattcaggccaaagagttcaatcttggtttcatcagaccagagaatcttgtttctcatggtcagagtcctttaggtgccttttggcaaactccaagcgggctgtcatgtgctttttcctgaggagtggctgctgtcttgccactctaccataaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1865795 True 268 lncRNA 0.50 1 46011289 46011556
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498001 NA coding downstream 5253 46003765 ~ 46008718 (-)
LOC118941484 NA coding downstream 9544 45996022 ~ 46001745 (-)
LOC110498000 NA coding downstream 39137 45963081 ~ 45983398 (-)
LOC110497995 LOC106580785 coding downstream 115429 45871839 ~ 45895860 (-)
LOC110497994 LOC106583609 coding downstream 139757 45867770 ~ 45871532 (-)
LOC110498002 LOC106580335 coding upstream 2164 46013720 ~ 46016760 (-)
LOC110498003 LOC106580283 coding upstream 181174 46192730 ~ 46205374 (-)
LOC110498582 LOC106583554 coding upstream 196764 46208320 ~ 46209797 (-)
LOC110498005 arhb coding upstream 321592 46333148 ~ 46415591 (-)
LOC110498006 LOC106579821 coding upstream 409172 46420728 ~ 46449566 (-)
G1630664 NA non-coding downstream 40628 45970191 ~ 45970661 (-)
G1630661 NA non-coding downstream 53746 45957219 ~ 45957543 (-)
G1630645 NA non-coding downstream 73673 45937146 ~ 45937616 (-)
G1630746 NA non-coding upstream 85383 46096939 ~ 46097148 (-)
G1630776 NA non-coding upstream 137211 46148767 ~ 46149224 (-)
G1630782 NA non-coding upstream 143764 46155320 ~ 46155540 (-)
G1630790 NA non-coding upstream 157242 46168798 ~ 46169074 (-)
G1630791 NA non-coding upstream 158563 46170119 ~ 46170486 (-)
G1627068 NA other downstream 2602180 43408727 ~ 43409109 (-)
G1626324 NA other downstream 3172855 42759294 ~ 42838434 (-)
G1626232 LOC106611303 other downstream 3370016 42640449 ~ 42641273 (-)
LOC110498355 atg2b other downstream 3540587 42465705 ~ 42480874 (-)
G1631005 NA other upstream 607651 46619207 ~ 46629506 (-)
G1631120 LOC106612182 other upstream 818778 46830334 ~ 46830650 (-)
G1632192 LOC106575636 other upstream 1904739 47916295 ~ 47980466 (-)
G1632228 NA other upstream 1956958 47968514 ~ 47970332 (-)
LOC110498045 LOC106575475 other upstream 2100357 48111907 ~ 48147170 (-)

Expression


G1630677 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1630677 Expression in each Bioproject

Bar chart with 21 bars.
G1630677 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network