G1630791



Basic Information


Item Value
gene id G1630791
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 46170119 ~ 46170486 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1865914
attttttcccattcctccttgcaaaacagctcaagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccatgccattgtagattttgctttatgttttggatcattgtcttgttggaagacacatctctgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttatccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccacc

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1865914 True 368 lncRNA 0.43 1 46170119 46170486

Neighbor


gene id symbol gene type direction distance location
LOC110498002 LOC106580335 coding downstream 153359 46013720 ~ 46016760 (-)
LOC110498001 NA coding downstream 164083 46003765 ~ 46008718 (-)
LOC118941484 NA coding downstream 168374 45996022 ~ 46001745 (-)
LOC110498000 NA coding downstream 197967 45963081 ~ 45983398 (-)
LOC110497995 LOC106580785 coding downstream 274259 45871839 ~ 45895860 (-)
LOC110498003 LOC106580283 coding upstream 22244 46192730 ~ 46205374 (-)
LOC110498582 LOC106583554 coding upstream 37834 46208320 ~ 46209797 (-)
LOC110498005 arhb coding upstream 162662 46333148 ~ 46415591 (-)
LOC110498006 LOC106579821 coding upstream 250242 46420728 ~ 46449566 (-)
LOC110498008 LOC106579881 coding upstream 291271 46461757 ~ 46472164 (-)
G1630790 NA non-coding downstream 1045 46168798 ~ 46169074 (-)
G1630782 NA non-coding downstream 14579 46155320 ~ 46155540 (-)
G1630776 NA non-coding downstream 20895 46148767 ~ 46149224 (-)
G1630746 NA non-coding downstream 72971 46096939 ~ 46097148 (-)
G1630677 NA non-coding downstream 158563 46011289 ~ 46011556 (-)
G1630793 NA non-coding upstream 2080 46172566 ~ 46172825 (-)
G1630800 NA non-coding upstream 20218 46190704 ~ 46191315 (-)
G1630820 NA non-coding upstream 54533 46225019 ~ 46225260 (-)
G1630825 NA non-coding upstream 63845 46234331 ~ 46234882 (-)
G1630857 NA non-coding upstream 123663 46294149 ~ 46294426 (-)
G1627068 NA other downstream 2761010 43408727 ~ 43409109 (-)
G1626324 NA other downstream 3331685 42759294 ~ 42838434 (-)
G1626232 LOC106611303 other downstream 3528846 42640449 ~ 42641273 (-)
LOC110498355 atg2b other downstream 3699417 42465705 ~ 42480874 (-)
G1631005 NA other upstream 448721 46619207 ~ 46629506 (-)
G1631120 LOC106612182 other upstream 659848 46830334 ~ 46830650 (-)
G1632192 LOC106575636 other upstream 1745809 47916295 ~ 47980466 (-)
G1632228 NA other upstream 1798028 47968514 ~ 47970332 (-)
LOC110498045 LOC106575475 other upstream 1941427 48111907 ~ 48147170 (-)

Expression


G1630791 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1630791 Expression in each Bioproject

Bar chart with 18 bars.
G1630791 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network