G1630820



Basic Information


Item Value
gene id G1630820
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 46225019 ~ 46225260 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1865947
ctgacattctcccaatcttcttctggatcttccaaatgctctctagcaaacatcagacgggcctggacatgtactggcttaagcagggggacacgtctggcactgcaggatttgagtccctggcggcgtagtgtgttactgatggtaggctttgttactttggtcccagctctctgcaggtcattcactaggtccccccgtgtggttctgggatttttgctcaccattcttgtgataatttt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1865947 True 242 lncRNA 0.50 1 46225019 46225260
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498582 LOC106583554 coding downstream 15222 46208320 ~ 46209797 (-)
LOC110498003 LOC106580283 coding downstream 19645 46192730 ~ 46205374 (-)
LOC110498002 LOC106580335 coding downstream 208259 46013720 ~ 46016760 (-)
LOC110498001 NA coding downstream 218983 46003765 ~ 46008718 (-)
LOC118941484 NA coding downstream 223274 45996022 ~ 46001745 (-)
LOC110498005 arhb coding upstream 107888 46333148 ~ 46415591 (-)
LOC110498006 LOC106579821 coding upstream 195468 46420728 ~ 46449566 (-)
LOC110498008 LOC106579881 coding upstream 236497 46461757 ~ 46472164 (-)
mgst3b LOC106579764 coding upstream 253463 46478723 ~ 46481326 (-)
syf2 syf2 coding upstream 272530 46497790 ~ 46505960 (-)
G1630800 NA non-coding downstream 33704 46190704 ~ 46191315 (-)
G1630793 NA non-coding downstream 52194 46172566 ~ 46172825 (-)
G1630791 NA non-coding downstream 54533 46170119 ~ 46170486 (-)
G1630790 NA non-coding downstream 55945 46168798 ~ 46169074 (-)
G1630782 NA non-coding downstream 69479 46155320 ~ 46155540 (-)
G1630825 NA non-coding upstream 9071 46234331 ~ 46234882 (-)
G1630857 NA non-coding upstream 68889 46294149 ~ 46294426 (-)
G1630891 NA non-coding upstream 192593 46417853 ~ 46418136 (-)
G1630693 NA non-coding upstream 203300 46428560 ~ 46428833 (-)
G1627068 NA other downstream 2815910 43408727 ~ 43409109 (-)
G1626324 NA other downstream 3386585 42759294 ~ 42838434 (-)
G1626232 LOC106611303 other downstream 3583746 42640449 ~ 42641273 (-)
LOC110498355 atg2b other downstream 3754317 42465705 ~ 42480874 (-)
G1631005 NA other upstream 393947 46619207 ~ 46629506 (-)
G1631120 LOC106612182 other upstream 605074 46830334 ~ 46830650 (-)
G1632192 LOC106575636 other upstream 1691035 47916295 ~ 47980466 (-)
G1632228 NA other upstream 1743254 47968514 ~ 47970332 (-)
LOC110498045 LOC106575475 other upstream 1886653 48111907 ~ 48147170 (-)

Expression


G1630820 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1630820 Expression in each Bioproject

Bar chart with 18 bars.
G1630820 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network