G1630321



Basic Information


Item Value
gene id G1630321
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 47005150 ~ 47005351 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1865393
gtagtagtagcagcagcagcagcacagtgaacagcagcagtagtagtagcacagtgaacagcagcagtagtagcagcagcagcacagtgaacagcagcagtagtagtagcacagtgaacagcagcagtagtagcagtagtagcagcagcagcacagtgaacagcagcagtagcagcagcacagtgaacagcagcagtagcag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1865393 True 202 lncRNA 0.52 1 47005150 47005351
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498028 LOC106578112 coding upstream 24332 46978173 ~ 46980818 (+)
gjb3 LOC106578429 coding upstream 78505 46922561 ~ 46926645 (+)
LOC110498023 LOC106578479 coding upstream 99907 46901413 ~ 46905243 (+)
ppie ppie coding upstream 101783 46895875 ~ 46903367 (+)
pabpc4 LOC106578531 coding upstream 110116 46879174 ~ 46895034 (+)
LOC110498029 NA coding downstream 275316 47280667 ~ 47338219 (+)
LOC110498032 LOC106577542 coding downstream 509473 47514824 ~ 47519654 (+)
LOC118941362 LOC106568776 coding downstream 759033 47764384 ~ 47765501 (+)
LOC110498042 icef1 coding downstream 856512 47861863 ~ 47937951 (+)
LOC110498039 LOC106575636 coding downstream 932794 47938145 ~ 47981306 (+)
G1630317 NA non-coding upstream 13404 46990887 ~ 46991746 (+)
G1630316 NA non-coding upstream 14334 46990412 ~ 46990816 (+)
G1630315 NA non-coding upstream 14935 46989311 ~ 46990215 (+)
G1630300 NA non-coding upstream 19568 46984832 ~ 46985582 (+)
G1630301 NA non-coding upstream 21811 46963349 ~ 46983339 (+)
G1630324 NA non-coding downstream 2765 47008116 ~ 47008477 (+)
G1630328 NA non-coding downstream 7453 47012804 ~ 47013043 (+)
G1630329 NA non-coding downstream 8005 47013356 ~ 47013556 (+)
G1630331 NA non-coding downstream 9213 47014564 ~ 47014940 (+)
G1630337 NA non-coding downstream 15785 47021136 ~ 47021384 (+)
LOC110498004 LOC106580093 other upstream 745502 46257919 ~ 46318609 (+)
G1629912 NA other upstream 779330 46225382 ~ 46225820 (+)
G1629779 LOC106580335 other upstream 988511 46013724 ~ 46016639 (+)
G1629210 NA other upstream 1488502 45516174 ~ 45516648 (+)
G1629200 NA other upstream 1502887 45501794 ~ 45502263 (+)
G1631702 NA other downstream 654775 47660126 ~ 47661235 (+)
G1631844 NA other downstream 742346 47747697 ~ 47749082 (+)
LOC110498044 LOC106575475 other downstream 1118597 48122225 ~ 48129380 (+)
LOC110498372 LOC106575065 other downstream 1573427 48251112 ~ 48583066 (+)
LOC110498046 LOC106574720 other downstream 1584274 48588944 ~ 48678169 (+)

Expression


G1630321 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1630321 Expression in each Bioproject

Bar chart with 6 bars.
G1630321 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network