G1633560



Basic Information


Item Value
gene id G1633560
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 48854592 ~ 48855059 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1869027
caaggttgcagcaaacacgacgatagtctggttcaggcatgagaaacacaaacaagaatccgacaaagacagaagcaggaacagagagagatatagagacctaatcagagggaaaaagggaacaggtgggaaaaggggtgaacgaggtagttagaggagacaaggaacagctgggggaaggagggtaaggaaaggtaacctaatacgaccagcagagggagacagggtgaagagaaagaacaggaacaagacacaacatgacaatacatgacagtaccccccccactcaccgagcgcctcctggcgcactcgaggaggaaacctggcggcaacggaggaaatcatcgatcagcgaacggtccagcacgtcccgagagggaacccaactcctttcctcaggaccgtacccctcccaatccactaggtactgatgaccacggccccgaggacgcatgtccaaaatcttac

Function


NR:

description
PREDICTED: thrombospondin-3b-like

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1869027 True 468 lncRNA 0.53 1 48854592 48855059

Neighbor


gene id symbol gene type direction distance location
LOC110498052 cln8 coding downstream 48438 48791774 ~ 48806154 (-)
LOC110498373 arhgef10 coding downstream 75141 48699004 ~ 48779451 (-)
LOC110498049 kbtbd11 coding downstream 157893 48684547 ~ 48696699 (-)
LOC110498047 LOC106574998 coding downstream 170841 48680179 ~ 48683751 (-)
LOC118941487 NA coding downstream 262568 48582101 ~ 48592024 (-)
LOC110498058 LOC106573748 coding upstream 511848 49366907 ~ 49455407 (-)
LOC110498059 LOC106573685 coding upstream 602023 49457082 ~ 49460760 (-)
LOC110498060 LOC106573624 coding upstream 610098 49465157 ~ 49469989 (-)
LOC110498061 LOC106573499 coding upstream 620614 49475673 ~ 49523365 (-)
LOC118941488 NA coding upstream 675866 49530925 ~ 49532277 (-)
G1633520 NA non-coding downstream 17116 48784346 ~ 48837476 (-)
G1633525 NA non-coding downstream 63312 48790686 ~ 48791280 (-)
G1633426 NA non-coding downstream 266205 48588185 ~ 48588387 (-)
G1633581 NA non-coding upstream 27364 48882423 ~ 48882855 (-)
G1633590 NA non-coding upstream 43124 48898183 ~ 48898383 (-)
G1633592 NA non-coding upstream 45198 48900257 ~ 48909682 (-)
G1633601 NA non-coding upstream 59936 48914995 ~ 48915242 (-)
G1633605 NA non-coding upstream 65133 48920192 ~ 48920401 (-)
LOC110498045 LOC106575475 other downstream 707422 48111907 ~ 48147170 (-)
G1632192 LOC106575636 other downstream 874126 47916295 ~ 47980466 (-)
G1632228 NA other downstream 884260 47968514 ~ 47970332 (-)
G1631120 LOC106612182 other downstream 2023942 46830334 ~ 46830650 (-)
G1631005 NA other downstream 2225086 46619207 ~ 46629506 (-)
LOC110498375 dlgap2 other upstream 40471 48812312 ~ 48896302 (-)
G1633961 NA other upstream 703978 49559037 ~ 49560131 (-)
G1634391 NA other upstream 900652 49755711 ~ 49827902 (-)
LOC110498073 NA other upstream 1335602 50190657 ~ 50193142 (-)

Expression


G1633560 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1633560 Expression in each Bioproject

Bar chart with 19 bars.
G1633560 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network