G1633590



Basic Information


Item Value
gene id G1633590
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 48898183 ~ 48898383 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1869058
gcagaagggtcttggtcagggaggtgaccaagaacccgatggtcactctgacagagctctagtcttcctctgtggagatgggagaaccttccagaaggacaaccatctctgcagcactccaccaatcaggcctttatggtagagtggccagacagaagccattcctcagtaaaaggcacatgacagcccgcttggagtttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1869058 True 201 lncRNA 0.53 1 48898183 48898383
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498375 dlgap2 coding downstream 1881 48812312 ~ 48896302 (-)
LOC110498052 cln8 coding downstream 92029 48791774 ~ 48806154 (-)
LOC110498373 arhgef10 coding downstream 118732 48699004 ~ 48779451 (-)
LOC110498049 kbtbd11 coding downstream 201484 48684547 ~ 48696699 (-)
LOC110498047 LOC106574998 coding downstream 214432 48680179 ~ 48683751 (-)
LOC110498058 LOC106573748 coding upstream 468524 49366907 ~ 49455407 (-)
LOC110498059 LOC106573685 coding upstream 558699 49457082 ~ 49460760 (-)
LOC110498060 LOC106573624 coding upstream 566774 49465157 ~ 49469989 (-)
LOC110498061 LOC106573499 coding upstream 577290 49475673 ~ 49523365 (-)
LOC118941488 NA coding upstream 632542 49530925 ~ 49532277 (-)
G1633581 NA non-coding downstream 15328 48882423 ~ 48882855 (-)
G1633560 NA non-coding downstream 43124 48854592 ~ 48855059 (-)
G1633520 NA non-coding downstream 60707 48784346 ~ 48837476 (-)
G1633525 NA non-coding downstream 106903 48790686 ~ 48791280 (-)
G1633592 NA non-coding upstream 1874 48900257 ~ 48909682 (-)
G1633601 NA non-coding upstream 16612 48914995 ~ 48915242 (-)
G1633605 NA non-coding upstream 21809 48920192 ~ 48920401 (-)
G1633611 NA non-coding upstream 30197 48928580 ~ 48928834 (-)
G1633612 NA non-coding upstream 30974 48929357 ~ 48929698 (-)
LOC110498045 LOC106575475 other downstream 751013 48111907 ~ 48147170 (-)
G1632192 LOC106575636 other downstream 917717 47916295 ~ 47980466 (-)
G1632228 NA other downstream 927851 47968514 ~ 47970332 (-)
G1631120 LOC106612182 other downstream 2067533 46830334 ~ 46830650 (-)
G1633961 NA other upstream 660654 49559037 ~ 49560131 (-)
G1634391 NA other upstream 857328 49755711 ~ 49827902 (-)
LOC110498073 NA other upstream 1292278 50190657 ~ 50193142 (-)
G1634769 LOC106571989 other upstream 1411327 50309710 ~ 50309971 (-)

Expression


G1633590 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1633590 Expression in each Bioproject

Bar chart with 21 bars.
G1633590 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network