G1635955



Basic Information


Item Value
gene id G1635955
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 51506887 ~ 51507261 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1871662
ccggtgacaaaatctaaggcgatgtgagaccacggtcgagagggaataggaagcggcctgagacggccggcaggaggagagttaccggacttagtctgcgcgcagaccgaacaagcagccacgaaacgacgcgtgtcatgctcccgggtgggccaccaaaaacgctggcgaatggaagcaagcgtaccccgaacgccagggtggccggctaacttggcagagtgagcccactgaagaacggccagacgagtaggaacgggaacgaaaataaggttcctaggacaagcgcgcggcgacggagtgtgagtgagcgcttgctttacctgcctctcaattccccagacagtcaacccgacaacacgcccctcagggaga

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1871662 True 375 lncRNA 0.60 1 51506887 51507261

Neighbor


gene id symbol gene type direction distance location
LOC110498087 LOC106571300 coding upstream 825913 50659972 ~ 50680974 (+)
LOC118936464 adf1 coding upstream 977544 50526941 ~ 50529343 (+)
heatr4 heatr4 coding upstream 980524 50520395 ~ 50526363 (+)
LOC118941376 NA coding upstream 990215 50514922 ~ 50516672 (+)
LOC110498081 NA coding upstream 1069104 50436698 ~ 50437783 (+)
LOC110498383 LOC106570236 coding downstream 435131 51942392 ~ 51992547 (+)
LOC110498384 LOC106570052 coding downstream 496864 52004125 ~ 52035886 (+)
tfb2m tfb2m coding downstream 600381 52107642 ~ 52118171 (+)
LOC110498094 LOC106569575 coding downstream 611207 52118468 ~ 52150151 (+)
hnrnpua hnrnpu coding downstream 1054462 52561723 ~ 52576154 (+)
G1635954 NA non-coding upstream 1255 51505346 ~ 51505632 (+)
G1635939 NA non-coding upstream 10176 51496454 ~ 51496711 (+)
G1635936 NA non-coding upstream 11264 51495348 ~ 51495623 (+)
G1635930 NA non-coding upstream 14276 51492190 ~ 51492611 (+)
G1635708 NA non-coding upstream 75465 51431104 ~ 51431422 (+)
G1635966 NA non-coding downstream 10367 51517628 ~ 51517866 (+)
G1635968 NA non-coding downstream 11842 51519103 ~ 51519350 (+)
G1635970 NA non-coding downstream 17285 51524546 ~ 51524779 (+)
G1635982 NA non-coding downstream 31522 51538783 ~ 51538999 (+)
G1636005 NA non-coding downstream 53852 51561113 ~ 51561529 (+)
G1634948 NA other upstream 896408 50607386 ~ 50610479 (+)
LOC110498078 LOC106572417 other upstream 1251635 50243497 ~ 50265945 (+)
LOC110498072 NA other upstream 1339501 50163645 ~ 50168749 (+)
zgc:193593 NA other upstream 2328485 49160705 ~ 49178402 (+)
G1632650 arhgef10 other upstream 2806319 48699057 ~ 48700568 (+)
G1637065 NA other downstream 1243339 52750600 ~ 52755474 (+)
G1637178 NA other downstream 1410076 52917337 ~ 52918478 (+)
G1637730 NA other downstream 1922743 53430004 ~ 53430560 (+)
G1638710 NA other downstream 2667535 54174796 ~ 54175130 (+)

Expression


G1635955 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1635955 Expression in each Bioproject

Bar chart with 6 bars.
G1635955 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network