G1636669



Basic Information


Item Value
gene id G1636669
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 51896788 ~ 51898508 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1872437
gtattaccagtaccagatcaatgtggatctatatacagggagtaccagtaccagatcaatatggagctatatccaggtattaccagtaccagatcaatgtggagctatatacaggtattaccagtaccagatcaatgtggagctatatacagggagcaccagtaccagatcaatgtggagctatatccaggtattaccagtaccatatcaatgtggagctatatacagggagcaccagtaccagatcaatgtggagctatatccagggagtaccagtaccagatcaatgtggagctatatacaggtattaacagtaccagatcaatgtggagctatatccagggagtaccagtaccatatcaatgtggagctatatac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1872437 True 378 TUCP 0.42 3 51896788 51898508
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498090 LOC106570958 coding downstream 421088 51185057 ~ 51475700 (-)
ush2a ush2a coding downstream 725007 50685344 ~ 51171781 (-)
LOC110498086 LOC106571381 coding downstream 1240076 50644442 ~ 50656712 (-)
LOC110498085 LOC106571499 coding downstream 1259814 50625461 ~ 50636974 (-)
LOC110498379 LOC106571436 coding downstream 1271467 50582713 ~ 50625321 (-)
ahctf1 ahctf1 coding upstream 149365 52047873 ~ 52086419 (-)
LOC110498093 LOC106569909 coding upstream 201341 52099849 ~ 52107525 (-)
kif26ba LOC106569018 coding upstream 430215 52328723 ~ 52545336 (-)
efcab2 efcab2 coding upstream 652915 52551423 ~ 52561345 (-)
LOC110498101 LOC106567792 coding upstream 765055 52663563 ~ 52734555 (-)
G1636262 NA non-coding downstream 14734 51881837 ~ 51882054 (-)
G1636254 NA non-coding downstream 28852 51867648 ~ 51867936 (-)
G1636248 NA non-coding downstream 34449 51861977 ~ 51862339 (-)
G1636237 NA non-coding downstream 43878 51852640 ~ 51852910 (-)
G1636228 NA non-coding downstream 53733 51842823 ~ 51843055 (-)
G1636699 NA non-coding upstream 52711 51951219 ~ 51952197 (-)
G1636704 NA non-coding upstream 72454 51970962 ~ 51990024 (-)
G1636780 NA non-coding upstream 237544 52136052 ~ 52187082 (-)
G1636786 NA non-coding upstream 250575 52149083 ~ 52150000 (-)
G1636788 NA non-coding upstream 256925 52155433 ~ 52156025 (-)
G1635971 NA other downstream 370368 51525986 ~ 51526420 (-)
G1635790 NA other downstream 624702 51270445 ~ 51272086 (-)
G1635484 NA other downstream 911044 50985295 ~ 50985744 (-)
G1635456 NA other downstream 962356 50930899 ~ 50934432 (-)
G1636861 NA other upstream 452461 52350969 ~ 52356149 (-)
G1638677 NA other upstream 2246689 54145197 ~ 54154105 (-)
G1639267 NA other upstream 2683498 54582006 ~ 54582351 (-)
G1641074 NA other upstream 4048065 55946573 ~ 55946964 (-)
G1641501 NA other upstream 4681980 56497389 ~ 56584678 (-)

Expression


G1636669 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1636669 Expression in each Bioproject

Bar chart with 14 bars.
G1636669 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network