G1636788



Basic Information


Item Value
gene id G1636788
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 52155433 ~ 52156025 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1872579
gttaagggcttgtaagtaagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctacctacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaagatctactacacctgttgtattcagcatttcactgtaaggtctacctacacctgttgtatttagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctacctacacctgttgtatttagcatttcactgtaaggtctacctacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1872579 True 516 lncRNA 0.39 2 52155433 52156025

Neighbor


gene id symbol gene type direction distance location
LOC110498093 LOC106569909 coding downstream 47908 52099849 ~ 52107525 (-)
ahctf1 ahctf1 coding downstream 69014 52047873 ~ 52086419 (-)
LOC110498090 LOC106570958 coding downstream 679733 51185057 ~ 51475700 (-)
ush2a ush2a coding downstream 983652 50685344 ~ 51171781 (-)
LOC110498086 LOC106571381 coding downstream 1498721 50644442 ~ 50656712 (-)
kif26ba LOC106569018 coding upstream 172698 52328723 ~ 52545336 (-)
efcab2 efcab2 coding upstream 395398 52551423 ~ 52561345 (-)
LOC110498101 LOC106567792 coding upstream 507538 52663563 ~ 52734555 (-)
LOC110498103 LOC106567335 coding upstream 680079 52836104 ~ 52849167 (-)
LOC110498106 LOC106567189 coding upstream 709720 52865745 ~ 52873380 (-)
G1636786 NA non-coding downstream 5433 52149083 ~ 52150000 (-)
G1636704 NA non-coding downstream 165409 51970962 ~ 51990024 (-)
G1636699 NA non-coding downstream 203236 51951219 ~ 51952197 (-)
G1636262 NA non-coding downstream 273379 51881837 ~ 51882054 (-)
G1636254 NA non-coding downstream 287497 51867648 ~ 51867936 (-)
G1636854 NA non-coding upstream 132629 52288654 ~ 52289963 (-)
G1636855 NA non-coding upstream 134303 52290328 ~ 52291675 (-)
G1636874 NA non-coding upstream 162170 52318195 ~ 52320093 (-)
G1636921 NA non-coding upstream 281465 52437490 ~ 52439840 (-)
G1636932 NA non-coding upstream 309303 52465328 ~ 52466032 (-)
G1636669 NA other downstream 256925 51896788 ~ 51898508 (-)
G1635971 NA other downstream 629013 51525986 ~ 51526420 (-)
G1635790 NA other downstream 883347 51270445 ~ 51272086 (-)
G1635484 NA other downstream 1169689 50985295 ~ 50985744 (-)
G1635456 NA other downstream 1221001 50930899 ~ 50934432 (-)
G1636861 NA other upstream 194944 52350969 ~ 52356149 (-)
G1638677 NA other upstream 1989172 54145197 ~ 54154105 (-)
G1639267 NA other upstream 2425981 54582006 ~ 54582351 (-)
G1641074 NA other upstream 3790548 55946573 ~ 55946964 (-)
G1641501 NA other upstream 4424463 56497389 ~ 56584678 (-)

Expression


G1636788 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1636788 Expression in each Bioproject

Bar chart with 17 bars.
G1636788 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network