G1641172



Basic Information


Item Value
gene id G1641172
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 56163829 ~ 56164118 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1877324
ctatatgtactgtgattctcatgattctatgtgtattgtgattctcatgattctcacgattctatatgtattgtgattctcatgattctatgtgtattgtgattctcatgattctatgtgtattgtgattctcatgattctatgtgtattgtgattctcatgattctatgtgtattgtgattctcatgattctatgtgtattgtgattctcatgattctatatgtattgtgattctcacgattctatatgtattgtgattctcatgtttttcacgattctatatgtattg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1877324 True 290 lncRNA 0.30 1 56163829 56164118
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118941491 LOC106562077 coding downstream 277638 55882882 ~ 55936463 (-)
LOC110498152 LOC106562166 coding downstream 302309 55788913 ~ 55861520 (-)
tmem30b LOC106562615 coding downstream 404077 55747931 ~ 55759752 (-)
LOC110498143 dylt1 coding downstream 714536 55448001 ~ 55449293 (-)
znf593 zn593 coding downstream 748078 55414462 ~ 55415751 (-)
trnaa-cgc-4 NA coding upstream 362465 56526583 ~ 56526653 (-)
LOC110498158 ctl2b coding upstream 626693 56790811 ~ 56794401 (-)
LOC110498160 LOC106560797 coding upstream 641438 56805556 ~ 56812107 (-)
LOC110498161 LOC106560842 coding upstream 659918 56824036 ~ 56837037 (-)
LOC118941497 LOC106609620 coding upstream 996944 57069887 ~ 57165047 (-)
G1641171 NA non-coding downstream 3660 56159945 ~ 56160169 (-)
G1641168 NA non-coding downstream 14117 56149375 ~ 56149712 (-)
G1641108 NA non-coding downstream 132647 56030765 ~ 56031182 (-)
G1641104 NA non-coding downstream 139810 56023622 ~ 56024019 (-)
G1641095 NA non-coding downstream 155058 56008572 ~ 56008771 (-)
G1641187 NA non-coding upstream 42965 56207083 ~ 56207450 (-)
G1641191 NA non-coding upstream 49410 56213528 ~ 56213764 (-)
G1641192 NA non-coding upstream 49726 56213844 ~ 56214105 (-)
G1641202 NA non-coding upstream 58673 56222791 ~ 56223130 (-)
G1641234 NA non-coding upstream 115455 56279573 ~ 56279845 (-)
G1641074 NA other downstream 216865 55946573 ~ 55946964 (-)
G1639267 NA other downstream 1581478 54582006 ~ 54582351 (-)
G1638677 NA other downstream 2009724 54145197 ~ 54154105 (-)
G1636861 NA other downstream 3807680 52350969 ~ 52356149 (-)
G1636669 NA other downstream 4265321 51896788 ~ 51898508 (-)
G1641501 NA other upstream 416370 56497389 ~ 56584678 (-)
G1641881 NA other upstream 820146 56984264 ~ 56984709 (-)
LOC110498390 LOC106612640 other upstream 1140608 57304724 ~ 57400864 (-)
LOC110498179 LOC106611855 other upstream 1732666 57893957 ~ 57955833 (-)

Expression


G1641172 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1641172 Expression in each Bioproject

Bar chart with 13 bars.
G1641172 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network