G1640929



Basic Information


Item Value
gene id G1640929
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 56173493 ~ 56189363 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1877065
cctcttttctctgtaatgctcttccccctcttttctctgtaatgctctttcccctctagtctctgtaatgctctaccccctcttttctctgtaatgctctttccactcttgtctctgtaatgctcttccccctcttgtctctgtaatgctctaccccctcttgtctctgtaatgctctttcccctcttgtctctgtaatgccctctcccctcttgtctctgtaatgctctttcccctcttttctctgtaatgctctaccccctcttttctctgtaatgctctaccccctcttttctctgtaatgctctaccccctcttttctctgtattgctctaccccctcttttctctgtaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1877065 True 355 lncRNA 0.46 2 56173493 56189363

Neighbor


gene id symbol gene type direction distance location
LOC110498153 LOC106561476 coding upstream 241414 55927603 ~ 55932079 (+)
LOC110498388 LOC106561476 coding upstream 290791 55852116 ~ 55882702 (+)
kdm1a LOC106562352 coding upstream 387772 55759827 ~ 55785721 (+)
htr1d LOC106562880 coding upstream 466765 55679068 ~ 55706728 (+)
LOC110498147 LOC106562977 coding upstream 690925 55473083 ~ 55482568 (+)
LOC118941492 LOC106612417 coding downstream 61250 56250613 ~ 56254784 (+)
LOC110498155 LOC106561796 coding downstream 255160 56444523 ~ 56584678 (+)
LOC118941494 NA coding downstream 344707 56534070 ~ 56538629 (+)
LOC110498162 LOC106560907 coding downstream 661542 56850905 ~ 56862683 (+)
LOC110498163 LOC106610662 coding downstream 869171 57058534 ~ 57062178 (+)
G1640923 NA non-coding upstream 27995 56145276 ~ 56145498 (+)
G1640864 NA non-coding upstream 131252 56041887 ~ 56042241 (+)
G1640860 NA non-coding upstream 145170 56028102 ~ 56028323 (+)
G1640835 NA non-coding upstream 166641 56006538 ~ 56006852 (+)
G1640841 NA non-coding upstream 181245 55990670 ~ 55992248 (+)
G1640940 NA non-coding downstream 19343 56208706 ~ 56211614 (+)
G1640942 NA non-coding downstream 24847 56214210 ~ 56214686 (+)
G1640952 NA non-coding downstream 37790 56227153 ~ 56227406 (+)
G1640968 NA non-coding downstream 75396 56264759 ~ 56264960 (+)
G1641221 NA non-coding downstream 80682 56270045 ~ 56270297 (+)
LOC110498128 LOC106610688 other upstream 1203883 54968308 ~ 54969856 (+)
G1638780 NA other upstream 1932742 54240256 ~ 54240751 (+)
G1638710 NA other upstream 1998363 54174796 ~ 54175130 (+)
G1637730 NA other upstream 2742933 53430004 ~ 53430560 (+)
G1641405 NA other downstream 310794 56500157 ~ 56505897 (+)
G1641407 NA other downstream 320566 56509929 ~ 56511097 (+)
G1641713 LOC106560842 other downstream 636589 56825952 ~ 56830309 (+)
G1641935 NA other downstream 946463 57135826 ~ 57143925 (+)
G1642062 NA other downstream 1085690 57275053 ~ 57276777 (+)

Expression


G1640929 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1640929 Expression in each Bioproject

Bar chart with 8 bars.
G1640929 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network