G1641192



Basic Information


Item Value
gene id G1641192
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 56213844 ~ 56214105 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1877345
aaaatgtactgtgtaacatgtcctattactgtcatctgatgaagattttcaaaaggttagtgaatgatttattttttaatcctgcgtttgttgattgcatgttttggctattcaaatgagctgtgtctggtggtggtttgacatatatatgcgctatgttttcgccgtaaaacattttagaaatctgacttgctggctagatgaacaaggtgtttatctttaatttgagctattggacttgttaatgtgtggaggttaaata

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1877345 True 262 lncRNA 0.34 1 56213844 56214105
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118941491 LOC106562077 coding downstream 327653 55882882 ~ 55936463 (-)
LOC110498152 LOC106562166 coding downstream 352324 55788913 ~ 55861520 (-)
tmem30b LOC106562615 coding downstream 454092 55747931 ~ 55759752 (-)
LOC110498143 dylt1 coding downstream 764551 55448001 ~ 55449293 (-)
znf593 zn593 coding downstream 798093 55414462 ~ 55415751 (-)
trnaa-cgc-4 NA coding upstream 312478 56526583 ~ 56526653 (-)
LOC110498158 ctl2b coding upstream 576706 56790811 ~ 56794401 (-)
LOC110498160 LOC106560797 coding upstream 591451 56805556 ~ 56812107 (-)
LOC110498161 LOC106560842 coding upstream 609931 56824036 ~ 56837037 (-)
LOC118941497 LOC106609620 coding upstream 946957 57069887 ~ 57165047 (-)
G1641191 NA non-coding downstream 80 56213528 ~ 56213764 (-)
G1641187 NA non-coding downstream 6394 56207083 ~ 56207450 (-)
G1641172 NA non-coding downstream 49726 56163829 ~ 56164118 (-)
G1641171 NA non-coding downstream 53675 56159945 ~ 56160169 (-)
G1641168 NA non-coding downstream 64132 56149375 ~ 56149712 (-)
G1641202 NA non-coding upstream 8686 56222791 ~ 56223130 (-)
G1641234 NA non-coding upstream 65468 56279573 ~ 56279845 (-)
G1641335 NA non-coding upstream 159053 56373158 ~ 56373369 (-)
G1641347 NA non-coding upstream 169096 56383201 ~ 56383435 (-)
G1641501 NA non-coding upstream 283284 56497389 ~ 56584678 (-)
G1641074 NA other downstream 266880 55946573 ~ 55946964 (-)
G1639267 NA other downstream 1631493 54582006 ~ 54582351 (-)
G1638677 NA other downstream 2059739 54145197 ~ 54154105 (-)
G1636861 NA other downstream 3857695 52350969 ~ 52356149 (-)
G1636669 NA other downstream 4315336 51896788 ~ 51898508 (-)
G1641881 NA other upstream 770159 56984264 ~ 56984709 (-)
LOC110498390 LOC106612640 other upstream 1090621 57304724 ~ 57400864 (-)
LOC110498179 LOC106611855 other upstream 1682679 57893957 ~ 57955833 (-)

Expression


G1641192 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1641192 Expression in each Bioproject

Bar chart with 4 bars.
G1641192 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network