G1643998


Basic Information

Item Value
gene id G1643998
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 58907861 ~ 58909339 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1880658
GGGACTACAACATTAAACATTTGCTCATCTTGAGGATTATAAATAACTCATTAAAACTATTTCCATACACATCATCAATGATATTCAATCTCTTGAGCTGCATAAGCTATATGTACAGTAAAGTGTCTTAGGGAATCCTTTCAAACATTTGCTAACAAATTGAACATCTGTCTCATTCACAATCCATTCAGTAAATCATATTGACACCACAATCCATTCAGTAAATCATATTGACAACACAATTCATTCAGTAAATCAAATTGACACCACAATGCATTCACTAAATCATATTGACACCACAATCCATTCAGTAAATCATATTGAAATCACAATCTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCCTTTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCCTTTCAGTAAAGCATATTGACACCACAATCCTTTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCCTTTCAGTAAAGCATATTGACACCACAATGTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTAAAGCATATTGACACCACAATCTATTCAGTGAAGCATATTGACACCACAATCTATTC

Function

NR:

description
uncharacterized protein LOC110539031

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1880658 True 819 TUCP 0.33 3 58907861 58909339
Loading

Neighbor

gene id symbol gene type direction distance location
rpusd2 LOC106608717 coding downstream 36191 58868964 ~ 58871670 (-)
LOC110498199 LOC106608927 coding downstream 93938 58709809 ~ 58813923 (-)
LOC110498197 LOC106610138 coding downstream 198414 58648347 ~ 58742086 (-)
yy1a LOC106610396 coding downstream 269956 58632136 ~ 58637905 (-)
im:7136021 LOC106610559 coding downstream 301130 58598508 ~ 58606731 (-)
bahd1 LOC106608351 coding upstream 21904 58931159 ~ 58959823 (-)
ivd LOC106608228 coding upstream 60980 58970319 ~ 58981150 (-)
pomk pomk coding upstream 72020 58981359 ~ 58983730 (-)
LOC110498209 LOC106608070 coding upstream 114234 59023573 ~ 59060963 (-)
LOC110498220 LOC106609318 coding upstream 733892 59643231 ~ 59648821 (-)
G1643992 NA non-coding downstream 11061 58893036 ~ 58896800 (-)
G1643990 NA non-coding downstream 17845 58886875 ~ 58890016 (-)
G1643988 NA non-coding downstream 24914 58882677 ~ 58882947 (-)
G1643987 NA non-coding downstream 26537 58881113 ~ 58881324 (-)
G1643968 NA non-coding downstream 60258 58847279 ~ 58847603 (-)
G1644004 NA non-coding upstream 13976 58923315 ~ 58923515 (-)
G1644007 NA non-coding upstream 14642 58923981 ~ 58924306 (-)
G1644052 NA non-coding upstream 55396 58964735 ~ 58965020 (-)
G1644053 NA non-coding upstream 55814 58965153 ~ 58965488 (-)
G1643293 dync1h1 other downstream 664075 58235945 ~ 58243786 (-)
LOC110498179 LOC106611855 other downstream 952028 57893957 ~ 57955833 (-)
LOC110498390 LOC106612640 other downstream 1596854 57304724 ~ 57400864 (-)
G1641881 NA other downstream 1923152 56984264 ~ 56984709 (-)
LOC110498158 ctl2b other downstream 2113488 56790811 ~ 56794401 (-)
G1645112 NA other upstream 1049748 59959087 ~ 59963520 (-)
G1645151 NA other upstream 1111623 60020962 ~ 60022612 (-)
G1645559 LOC106606422 other upstream 1174398 60083737 ~ 60122339 (-)
LOC110498401 LOC106606698 other upstream 1272306 60181600 ~ 60260595 (-)

Expression

G1643998 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1643998 Expression in each Bioproject

Bar chart with 9 bars.
G1643998 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network