G1647397



Basic Information


Item Value
gene id G1647397
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 63048226 ~ 63048719 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1884957
aacagtagggcactatactgtataggactctggtcaacagtagggcactatactgtataggactctggtcaacagtagggcactatactgtataggactcaacagtagggcactatactgtagaggactctggtcaacagtagggcactatactgtagaggactctggtcaacagtagggcactatactgtataggactctggtcaacagtagggcactatactgtataggactctggtcaacagtagggcactatactgtagaggactctggtcaacagtagggcactatactgtaaaggaatggtcaacagtagggcactatactgtagaggactctggtcaacagtagggcactatactgtagaggactctggtcaacagtagggcactatactgtaaaggactctggtcaacagtagggcactatactgtagaggactctggtcaacagtagggcactatactgtagaggactctggtcaacagtagggc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1884957 True 494 lncRNA 0.47 1 63048226 63048719

Neighbor


gene id symbol gene type direction distance location
LOC100136022 NA coding upstream 7320 62885583 ~ 63042917 (+)
LOC110512290 LOC106600942 coding upstream 276270 62655733 ~ 62771956 (+)
LOC110504278 LOC102780996 coding upstream 410100 62604904 ~ 62638126 (+)
LOC110504279 LOC106599953 coding upstream 445452 62500076 ~ 62602774 (+)
srsf5a LOC106611464 coding upstream 554588 62486921 ~ 62493719 (+)
map3k9 map3k9 coding downstream 2098 63050817 ~ 63103044 (+)
med6 med6 coding downstream 92704 63141423 ~ 63152629 (+)
pcnx1 pcnx1 coding downstream 104634 63153353 ~ 63232158 (+)
LOC110498282 NA coding downstream 199903 63248622 ~ 63287372 (+)
LOC110498284 chp1 coding downstream 243850 63292569 ~ 63309243 (+)
G1647349 NA non-coding upstream 117223 62930573 ~ 62931003 (+)
G1647335 NA non-coding upstream 135233 62912566 ~ 62912993 (+)
G1647330 NA non-coding upstream 139909 62907012 ~ 62908317 (+)
G1647325 NA non-coding upstream 150944 62897063 ~ 62897282 (+)
G1647411 NA non-coding downstream 26430 63075149 ~ 63077143 (+)
G1647437 NA non-coding downstream 66360 63115079 ~ 63115647 (+)
G1647431 NA non-coding downstream 67038 63115757 ~ 63116831 (+)
G1647433 NA non-coding downstream 73048 63121767 ~ 63124124 (+)
G1647477 NA non-coding downstream 154037 63202756 ~ 63204057 (+)
G1647342 NA other upstream 29538 63016955 ~ 63018688 (+)
G1646509 NA other upstream 902936 62144183 ~ 62145290 (+)
G1646294 NA other upstream 1487142 61558041 ~ 61561084 (+)
G1646225 NA other upstream 1703072 61344787 ~ 61345154 (+)
LOC110498409 LOC106592792 other downstream 342906 63380908 ~ 63414582 (+)
G1648296 NA other downstream 1079489 64128208 ~ 64129068 (+)
G1648608 NA other downstream 1931645 64980364 ~ 64980943 (+)

Expression


G1647397 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1647397 Expression in each Bioproject

Bar chart with 15 bars.
G1647397 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network