G1650384



Basic Information


Item Value
gene id G1650384
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 66798003 ~ 66798356 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1889117
tttggatgaaaagcatgcccaaattaaacggcctgctactcgggcccagaagatatgatatgcatataactggtagatttggatagaaaacactctaaagtttccaaaactgttaaaatagtgtctgtgagtataacataactgatttagcaggcgaaaacttgagaaaaatccatccaggaagtagtttttttgttggttttgtagaaattcaatgccattacagtatccattgacttaggactcaatttgcagttcctatgccttccactagatgtcaacagtctttagaaatcgtttcaggcttgtattcttataaataagggagtaagaccagtctgaatgagtggaccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1889117 True 354 lncRNA 0.37 1 66798003 66798356

Neighbor


gene id symbol gene type direction distance location
slc4a11 slc4a11 coding downstream 124207 66578657 ~ 66684644 (-)
rab11fip5a LOC106565696 coding downstream 313708 66426051 ~ 66484295 (-)
LOC118941528 NA coding downstream 414332 66380655 ~ 66383671 (-)
LOC110498311 LOC106593289 coding downstream 478513 66290478 ~ 66319490 (-)
LOC110514564 LOC105015915 coding downstream 808911 65833395 ~ 65989092 (-)
LOC110498422 LOC106566220 coding upstream 122157 66920513 ~ 66924201 (-)
LOC110498309 LOC106607996 coding upstream 289279 67087635 ~ 67156319 (-)
G1650383 NA non-coding downstream 81 66797589 ~ 66797922 (-)
G1650382 NA non-coding downstream 1150 66796512 ~ 66796853 (-)
G1650368 NA non-coding downstream 4259 66793519 ~ 66793744 (-)
G1650360 NA non-coding downstream 10043 66787683 ~ 66787960 (-)
G1650359 NA non-coding downstream 11585 66786116 ~ 66786418 (-)
G1650385 NA non-coding upstream 114 66798470 ~ 66798786 (-)
G1650418 NA non-coding upstream 22114 66820470 ~ 66822123 (-)
G1650431 NA non-coding upstream 30296 66828652 ~ 66830914 (-)
G1650430 NA non-coding upstream 37209 66835565 ~ 66837300 (-)
G1650429 NA non-coding upstream 38480 66836836 ~ 66847045 (-)
G1650308 NA other downstream 72435 66718406 ~ 66770326 (-)
G1650150 NA other downstream 242309 66554926 ~ 66555694 (-)
G1649975 NA other downstream 466517 66330804 ~ 66331486 (-)
G1649479 NA other downstream 1193721 65600883 ~ 65604282 (-)
G1649471 NA other downstream 1209514 65585961 ~ 65591888 (-)
G1650701 NA other upstream 370622 67168978 ~ 67169390 (-)

Expression


G1650384 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1650384 Expression in each Bioproject

Bar chart with 19 bars.
G1650384 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network