LOC118942459


Basic Information

Item Value
gene id LOC118942459
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 370810 ~ 370963 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XR_005038396.1
aactcttagcggtggatcactcggctcgtgagtcgatgaagaacgcagctagctgcgagaactaatgtgaattgcaggacacattgatcattgacacttcgaacgcactttgcggccccaggttcctcctggggctacgcctgtctgagggtcg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_005038396.1 True 154 mRNA 0.55 1 370810 370963
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118942430 NA coding upstream 4895 365797 ~ 365915 (+)
LOC118942453 NA coding upstream 5274 365418 ~ 365536 (+)
LOC118942481 zgc:158463 coding downstream 8532 374708 ~ 381316 (+)
LOC110498789 LOC106578306 coding downstream 55298 426261 ~ 500477 (+)
LOC110498715 NA coding downstream 126965 497928 ~ 515129 (+)
LOC110498790 LOC106578304 coding downstream 164524 535487 ~ 574538 (+)
LOC110498791 brsk1 coding downstream 242213 613176 ~ 643697 (+)
G1650761 NA non-coding upstream 159 370154 ~ 370651 (+)
G1650742 NA non-coding upstream 143956 226052 ~ 226854 (+)
G1650739 NA non-coding upstream 147036 223152 ~ 223774 (+)
G1650738 NA non-coding upstream 147771 222830 ~ 223039 (+)
G1650766 NA non-coding downstream 4505 375468 ~ 377894 (+)
G1650772 NA non-coding downstream 14294 385257 ~ 389245 (+)
G1650773 NA non-coding downstream 14890 385853 ~ 390306 (+)
G1650774 NA non-coding downstream 15822 386785 ~ 390619 (+)
G1652131 NA other downstream 1277959 1648922 ~ 1649135 (+)
G1652237 NA other downstream 1372960 1743923 ~ 1744380 (+)
G1654400 NA other downstream 3526140 3897103 ~ 3897390 (+)
G1654426 NA other downstream 3578474 3949437 ~ 3955465 (+)

Expression

LOC118942459 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network