trnaf-gaa-85


Basic Information

Item Value
gene id trnaf-gaa-85
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 4388563 ~ 4388635 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnaf-gaa-85
gccgaaatagctcagttgggagagcgttagactgaagatctaaaggtccctggttcgatccctggtttcggca

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnaf-gaa-85 True 73 mRNA 0.52 1 4388563 4388635

Neighbor

gene id symbol gene type direction distance location
trnai-aau-5 NA coding upstream 83 4388407 ~ 4388480 (+)
trnaf-gaa-84 NA coding upstream 1024 4387467 ~ 4387539 (+)
LOC110498828 LOC106578366 coding upstream 213718 4150196 ~ 4210102 (+)
trnai-uau-45 NA coding upstream 783455 3605015 ~ 3605108 (+)
trnai-uau-44 NA coding upstream 793837 3594633 ~ 3594726 (+)
trnai-aau-6 NA coding downstream 869 4389504 ~ 4389577 (+)
trnaf-aaa NA coding downstream 1025 4389660 ~ 4389732 (+)
trnai-aau-7 NA coding downstream 1544 4390179 ~ 4390252 (+)
trnaf-gaa-86 NA coding downstream 1700 4390335 ~ 4390407 (+)
trnai-aau-8 NA coding downstream 2230 4390865 ~ 4390938 (+)
G1655102 NA non-coding upstream 18651 4368630 ~ 4369912 (+)
G1654934 NA non-coding upstream 26134 4362200 ~ 4362429 (+)
G1654867 NA non-coding upstream 55507 4250718 ~ 4333056 (+)
G1654756 NA non-coding upstream 279552 4108774 ~ 4109011 (+)
G1655117 NA non-coding downstream 5521 4394156 ~ 4396122 (+)
G1655115 NA non-coding downstream 10233 4398868 ~ 4399256 (+)
G1655133 NA non-coding downstream 58525 4447160 ~ 4611082 (+)
G1655163 NA non-coding downstream 137096 4525731 ~ 4528180 (+)
G1655199 NA non-coding downstream 232007 4620642 ~ 4620852 (+)
G1654426 NA other upstream 433098 3949437 ~ 3955465 (+)
G1654400 NA other upstream 491173 3897103 ~ 3897390 (+)
G1652237 NA other upstream 2644183 1743923 ~ 1744380 (+)
G1652131 NA other upstream 2739428 1648922 ~ 1649135 (+)
LOC110498791 brsk1 other upstream 3744939 613176 ~ 643697 (+)
G1655848 NA other downstream 838917 5227552 ~ 5229928 (+)
G1656720 NA other downstream 1601839 5990474 ~ 5993750 (+)
wu:fj29h11 LOC106589505 other downstream 2627030 7015665 ~ 7074332 (+)
G1658572 NA other downstream 3315871 7704506 ~ 7705151 (+)
unk LOC106589472 other downstream 4005036 8392044 ~ 8401533 (+)

Expression

trnaf-gaa-85 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network