trnaa-agc-8



Basic Information


Item Value
gene id trnaa-agc-8
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 9329070 ~ 9329142 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaa-agc-8
gggggattagctcaaatggtagagcgctcgcttagcatgcgagaggtagcgggatcgatgcccgcatcctcca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaa-agc-8 True 73 mRNA 0.59 1 9329070 9329142
Loading

Neighbor


gene id symbol gene type direction distance location
pkd1b LOC106589455 coding downstream 18220 9281357 ~ 9310850 (-)
spata20 spata20 coding downstream 57557 9193289 ~ 9271513 (-)
LOC110498733 cacna1g coding downstream 289749 8840691 ~ 9039321 (-)
LOC110498925 uts2r coding downstream 534479 8719208 ~ 8794591 (-)
LOC110498924 LOC106589234 coding downstream 752555 8575197 ~ 8576515 (-)
nme2a LOC106589447 coding upstream 177232 9506374 ~ 9513698 (-)
LOC110498935 LOC106589231 coding upstream 219796 9548938 ~ 9552737 (-)
LOC110498737 ca10 coding upstream 348758 9677900 ~ 9986739 (-)
LOC110498936 LOC106589191 coding upstream 1280605 10609747 ~ 10668872 (-)
LOC110498937 LOC106589191 coding upstream 1374239 10703381 ~ 10704272 (-)
G1660898 NA non-coding downstream 132183 9185730 ~ 9196887 (-)
G1660452 NA non-coding downstream 143959 9184824 ~ 9185111 (-)
G1660451 LOC105030512 non-coding downstream 144358 9183905 ~ 9184712 (-)
G1660449 NA non-coding downstream 145938 9182850 ~ 9183132 (-)
G1660433 NA non-coding downstream 158108 9170652 ~ 9170962 (-)
G1660967 LOC106589233 non-coding upstream 2618 9331760 ~ 9334929 (-)
G1660981 NA non-coding upstream 28910 9358052 ~ 9359601 (-)
G1661017 LOC106589452 non-coding upstream 62743 9391885 ~ 9395929 (-)
G1660999 NA non-coding upstream 102639 9431781 ~ 9439407 (-)
G1661056 NA non-coding upstream 145447 9474589 ~ 9474809 (-)
LOC110498913 h3f3b other downstream 939816 8386968 ~ 8389308 (-)
LOC110498864 LOC106589517 other downstream 2757615 6568700 ~ 6582912 (-)
G1657869 LOC106589521 other downstream 2819490 6509119 ~ 6509580 (-)
G1657868 LOC106589521 other downstream 2821141 6505621 ~ 6507929 (-)
G1657862 NA other downstream 2828862 6499834 ~ 6500208 (-)
G1661023 NA other upstream 69975 9399117 ~ 9400947 (-)
G1661001 LOC106589450 other upstream 93641 9422783 ~ 9460115 (-)
G1662039 NA other upstream 1147821 10476963 ~ 10477185 (-)
LOC110498953 NA other upstream 1792771 11121913 ~ 11158776 (-)
G1663264 NA other upstream 2213474 11542616 ~ 11543091 (-)

Expression


trnaa-agc-8 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network