LOC118942478



Basic Information


Item Value
gene id LOC118942478
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 21941720 ~ 21941847 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005038414.1
CCAGTCTGAAAATCACCTTTGATATCTCTATTGTCTGGGGTGAGATTACAGGGCCTATAGTACTGTGGTACGTTAAGCTTATTGCCTGCTCTGTATAGCAGTGTGATTAAACCCATGTGCCTACAATC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005038414.1 True 128 mRNA 0.43 1 21941720 21941847
Loading

Neighbor


gene id symbol gene type direction distance location
gspt1 gspt1 coding upstream 5255 21924825 ~ 21936465 (+)
dmc1 LOC106609504 coding upstream 22111 21907617 ~ 21919609 (+)
tomm22 LOC106589546 coding upstream 34499 21902605 ~ 21907221 (+)
tmem184ba LOC106609488 coding upstream 47163 21876875 ~ 21894557 (+)
LOC110499080 LOC106609470 coding upstream 65261 21867834 ~ 21876459 (+)
LOC118942479 NA coding downstream 5551 21947398 ~ 21947525 (+)
LOC118942480 NA coding downstream 11161 21953008 ~ 21953135 (+)
LOC110499590 tnfrsf17 coding downstream 30891 21972738 ~ 21974195 (+)
snx29 snx29 coding downstream 32491 21974338 ~ 22091580 (+)
cpped1 cpped1 coding downstream 310284 22252131 ~ 22318724 (+)
G1673778 NA non-coding upstream 39640 21901867 ~ 21902080 (+)
G1673775 LOC106589545 non-coding upstream 41538 21896765 ~ 21900182 (+)
G1673768 NA non-coding upstream 75625 21865886 ~ 21866095 (+)
G1673766 NA non-coding upstream 77038 21864483 ~ 21864682 (+)
G1673765 NA non-coding upstream 77904 21863587 ~ 21863816 (+)
G1673797 NA non-coding downstream 2181 21944028 ~ 21950021 (+)
G1673798 NA non-coding downstream 7400 21949247 ~ 21955161 (+)
G1673803 NA non-coding downstream 24087 21965934 ~ 21966202 (+)
G1673783 NA non-coding downstream 26790 21968637 ~ 21971293 (+)
tnrc6b LOC106589538 other upstream 95854 21806703 ~ 21848442 (+)
G1673231 LOC106589530 other upstream 491374 21444883 ~ 21450346 (+)
LOC110499100 LOC106589528 other upstream 504339 21422168 ~ 21437402 (+)
G1673204 NA other upstream 551942 21386329 ~ 21389778 (+)
G1673063 NA other upstream 624308 21316798 ~ 21317412 (+)
LOC110499192 LOC106589579 other downstream 1314957 23252800 ~ 23269058 (+)
faap100 faap100 other downstream 1638183 23576429 ~ 23582556 (+)
G1677419 LOC100194703 other downstream 3140817 25082664 ~ 25083277 (+)
G1677738 NA other downstream 3694844 25636691 ~ 25641614 (+)
G1678963 NA other downstream 4520347 26462194 ~ 26467953 (+)

Expression


LOC118942478 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

LOC118942478 Expression in each Bioproject

Bar chart with 10 bars.
LOC118942478 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network