G1654400



Basic Information


Item Value
gene id G1654400
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 3897103 ~ 3897390 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1893645
cctcagaccccttgtgagaccatatgctggtgcggttggccctgggttcctcctaatgcaagacactgctagacctcatgtggctggagtgtgtcaccagttcctgcaagaggagggcattgatgctatggactggcccgcccgtttcccagacctgaatccaattgagcacatcttgaacatcatgtctcgctccatccaccaacgccacgttgcaccacagactgtccaggagttggcggatgctttagtccaggtctgggaggagatccctcaagagaccatccg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1893645 True 288 TUCP 0.56 1 3897103 3897390

Neighbor


gene id symbol gene type direction distance location
trnai-uau-45 NA coding upstream 291995 3605015 ~ 3605108 (+)
trnai-uau-44 NA coding upstream 302377 3594633 ~ 3594726 (+)
trnai-uau-43 NA coding upstream 330174 3566836 ~ 3566929 (+)
trnai-uau-42 NA coding upstream 336259 3560751 ~ 3560844 (+)
trnai-uau-41 NA coding upstream 348909 3548101 ~ 3548194 (+)
LOC110498828 LOC106578366 coding downstream 252806 4150196 ~ 4210102 (+)
trnaf-gaa-84 NA coding downstream 490077 4387467 ~ 4387539 (+)
trnai-aau-5 NA coding downstream 491017 4388407 ~ 4388480 (+)
trnaf-gaa-85 NA coding downstream 491173 4388563 ~ 4388635 (+)
trnai-aau-6 NA coding downstream 492114 4389504 ~ 4389577 (+)
G1654397 NA non-coding upstream 2656 3894222 ~ 3894447 (+)
G1654382 NA non-coding upstream 23048 3873651 ~ 3874055 (+)
G1654381 NA non-coding upstream 23691 3873189 ~ 3873412 (+)
G1654375 LOC106609167 non-coding upstream 34672 3862130 ~ 3862431 (+)
G1654326 NA non-coding upstream 45978 3788675 ~ 3851125 (+)
G1654407 NA non-coding downstream 11467 3908857 ~ 3909128 (+)
G1654431 NA non-coding downstream 67266 3964656 ~ 3964900 (+)
G1654750 NA non-coding downstream 207212 4104602 ~ 4104818 (+)
G1654755 NA non-coding downstream 211098 4108488 ~ 4108737 (+)
G1654756 NA non-coding downstream 211384 4108774 ~ 4109011 (+)
G1652237 NA other upstream 2152723 1743923 ~ 1744380 (+)
G1652131 NA other upstream 2247968 1648922 ~ 1649135 (+)
LOC110498791 brsk1 other upstream 3253479 613176 ~ 643697 (+)
G1654426 NA other downstream 52047 3949437 ~ 3955465 (+)
G1655848 NA other downstream 1330162 5227552 ~ 5229928 (+)
G1656720 NA other downstream 2093084 5990474 ~ 5993750 (+)
wu:fj29h11 LOC106589505 other downstream 3118275 7015665 ~ 7074332 (+)
G1658572 NA other downstream 3807116 7704506 ~ 7705151 (+)

Expression


G1654400 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1654400 Expression in each Bioproject

Bar chart with 13 bars.
G1654400 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network