G1655336



Basic Information


Item Value
gene id G1655336
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 4805192 ~ 4805580 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1894714
ataaaagacacctgtccacaacctcaaacagtcacactccaaactccactatggccaagaccaaagagctgtcaaaggacaccagaaacaaaattgtagacctgcaccaggctgggaagactgaatctgcaataggtaagcagcttggtttgaagaaatcaactgtgggagcaattattaggaaatggaagacatacaagaccactgataatctccctcggtctggggctccacgcaggatctcaccccgtggggtcaaaattatcacaagaacggtgagcaaaaatcccagaaccacacggggggacctagtgaatgacctgcagagagctgggaccaaagtaacaaagcctaccatcagcaagggcattgaagatgaaacgtggctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1894714 True 389 TUCP 0.48 1 4805192 4805580
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498832 LOC106578311 coding downstream 15286 4787586 ~ 4789906 (-)
LOC110498830 LOC106578308 coding downstream 48610 4730955 ~ 4756582 (-)
LOC118942306 NA coding downstream 132627 4672448 ~ 4672565 (-)
LOC118942424 NA coding downstream 133901 4671173 ~ 4671583 (-)
LOC118942451 NA coding downstream 135202 4669871 ~ 4669990 (-)
trnah-gug-108 NA coding upstream 145815 4951395 ~ 4951466 (-)
LOC110498834 LOC106578313 coding upstream 171682 4977262 ~ 4980126 (-)
LOC110498835 LOC106578314 coding upstream 203297 5008877 ~ 5030175 (-)
LOC110498836 LOC106578315 coding upstream 268360 5073940 ~ 5161314 (-)
LOC110499577 LOC106578324 coding upstream 356008 5161588 ~ 5176857 (-)
G1655330 NA non-coding downstream 4389 4800355 ~ 4800803 (-)
G1655327 NA non-coding downstream 12617 4792256 ~ 4792575 (-)
G1655326 NA non-coding downstream 13758 4791165 ~ 4791434 (-)
G1655309 LOC106578309 non-coding downstream 34063 4770697 ~ 4771129 (-)
G1655343 NA non-coding upstream 7591 4813171 ~ 4813788 (-)
G1655350 NA non-coding upstream 18461 4824041 ~ 4824320 (-)
G1655352 NA non-coding upstream 20584 4826164 ~ 4826527 (-)
G1655353 NA non-coding upstream 21413 4826993 ~ 4827340 (-)
G1655416 NA non-coding upstream 80310 4885890 ~ 4886094 (-)
G1655098 NA other downstream 441209 4363716 ~ 4363983 (-)
LOC110498829 LOC106578368 other downstream 472285 4217971 ~ 4333041 (-)
ablim1b ablim1 other downstream 1123399 3628495 ~ 3705213 (-)
G1654127 NA other downstream 1433791 3370901 ~ 3371401 (-)
lyrm1 lyrm1 other upstream 1039181 5844691 ~ 5854645 (-)
G1656633 LOC106578283 other upstream 1052380 5857960 ~ 5861471 (-)
LOC110498853 ube2i other upstream 1431225 6236177 ~ 6261266 (-)
LOC110498857 LOC101479821 other upstream 1530102 6335525 ~ 6344649 (-)

Expression


G1655336 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1655336 Expression in each Bioproject

Bar chart with 20 bars.
G1655336 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network