G1655877



Basic Information


Item Value
gene id G1655877
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 5267740 ~ 5316240 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1895306
gcgacttgtatgctctagtcggctggccctcgctacatattcgtcgccagacccactggctccaggtcatctacaagtccatgctaggtaaagtccccccttatctcagttcgctggtcaccatagcagcacccacctgtagcatgtgctccagcaggtatatctctctggtcacccccaaaaccaattcttcctttggccgcctctccttccagttctctgctgccaatgactgaaacgaactacaaaaatctctgaaactggaaacacttatctccctcactagctttaagcaccagctgtcagagcagctcacagattactgcacctgtacatagcccatctataatttagcccaaacaactacctcttcccctactgtatttatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1895306 True 389 lncRNA 0.49 2 5267740 5316240

Neighbor


gene id symbol gene type direction distance location
LOC110498833 LOC106578312 coding upstream 318461 4944360 ~ 4949279 (+)
LOC110498831 LOC106578309 coding upstream 478941 4761286 ~ 4788799 (+)
LOC118942464 NA coding upstream 548008 4719617 ~ 4719732 (+)
LOC118942462 NA coding upstream 550510 4717115 ~ 4717230 (+)
LOC118942425 NA coding upstream 552690 4714932 ~ 4715050 (+)
LOC110498838 LOC106578287 coding downstream 311477 5627717 ~ 5631151 (+)
LOC118942058 NA coding downstream 335447 5651687 ~ 5652425 (+)
LOC110498726 NA coding downstream 492611 5808851 ~ 5842228 (+)
LOC110498841 LOC106578283 coding downstream 536978 5853218 ~ 5859461 (+)
LOC110498842 LOC106578280 coding downstream 544341 5860581 ~ 5908467 (+)
G1655848 NA non-coding upstream 38614 5227552 ~ 5229928 (+)
G1655833 NA non-coding upstream 57742 5209172 ~ 5209998 (+)
G1655657 NA non-coding upstream 195373 5070386 ~ 5072367 (+)
G1655638 NA non-coding upstream 211956 5055489 ~ 5055784 (+)
G1655633 NA non-coding upstream 214977 5052427 ~ 5052763 (+)
G1656161 NA non-coding downstream 171289 5487529 ~ 5493333 (+)
G1656172 NA non-coding downstream 189380 5505620 ~ 5505926 (+)
G1656224 NA non-coding downstream 273228 5589468 ~ 5591268 (+)
G1656225 NA non-coding downstream 285552 5601792 ~ 5602271 (+)
G1656228 NA non-coding downstream 297981 5614221 ~ 5619192 (+)
G1654426 NA other upstream 1312275 3949437 ~ 3955465 (+)
G1654400 NA other upstream 1370350 3897103 ~ 3897390 (+)
G1652237 NA other upstream 3523360 1743923 ~ 1744380 (+)
G1652131 NA other upstream 3618605 1648922 ~ 1649135 (+)
G1656720 NA other downstream 674234 5990474 ~ 5993750 (+)
wu:fj29h11 LOC106589505 other downstream 1699425 7015665 ~ 7074332 (+)
G1658572 NA other downstream 2388266 7704506 ~ 7705151 (+)
unk LOC106589472 other downstream 3077431 8392044 ~ 8401533 (+)
LOC110498922 cssa28h17orf62 other downstream 3208052 8524125 ~ 8527761 (+)

Expression


G1655877 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1655877 Expression in each Bioproject

Bar chart with 21 bars.
G1655877 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network