G1656402 (yo84)



Basic Information


Item Value
gene id G1656402
gene name yo84
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 5686855 ~ 5693419 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1895888
tttctgatttttgcaatgttacgtagatggaaaaaagctgtccttgaaatggtcttgatatgttcttcaaaagagagatcagggtccagagtaacgccgaggtccttcacagttttatttgagacgactgtacaaccattaagattaattgtcagattcaacagaagatctctttgtttcttgggacctagaacaagcatctctgttttgtctgagtttaaaagtagaacgtttgcagccatccacttccttatgtctgaaacacatgcttctagcaagggcaattttggggcttcaccatgtttcattgaaatgtacagctgtgtgtcatccgcatagcagtgaaagttaacattatgttttcgaataacatccccaagaggtaaaatatatagtgaaaacaatagtggtcctaaaacggaaccttgaggaacaccgaaatttacagttgatttgtcagaggacaaaccattcacagagacaaactgatatctttccgacagataagatctaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1895888 True 515 lncRNA 0.38 2 5686855 5693419
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498725 med24 coding downstream 10062 5644069 ~ 5676793 (-)
LOC110499578 LOC106578289 coding downstream 128032 5557807 ~ 5558823 (-)
LOC110498837 rara coding downstream 293754 5228922 ~ 5393101 (-)
LOC110499577 LOC106578324 coding downstream 509998 5161588 ~ 5176857 (-)
LOC110498836 LOC106578315 coding downstream 525541 5073940 ~ 5161314 (-)
LOC110498839 LOC106578296 coding upstream 10080 5703499 ~ 5736631 (-)
lyrm1 lyrm1 coding upstream 151272 5844691 ~ 5854645 (-)
LOC110498843 NA coding upstream 199676 5893095 ~ 5893930 (-)
LOC118942082 NA coding upstream 249637 5941075 ~ 5944173 (-)
eps8l1b LOC106578277 coding upstream 250641 5944060 ~ 5958296 (-)
G1656400 NA non-coding downstream 2995 5683638 ~ 5683860 (-)
G1656399 NA non-coding downstream 4315 5682322 ~ 5682540 (-)
G1656383 NA non-coding downstream 43319 5643247 ~ 5643536 (-)
G1656295 LOC106578287 non-coding downstream 58040 5628256 ~ 5628815 (-)
G1656291 NA non-coding downstream 62812 5623825 ~ 5624043 (-)
G1656449 NA non-coding upstream 64164 5757583 ~ 5757879 (-)
G1656459 NA non-coding upstream 69139 5762558 ~ 5762801 (-)
G1656553 NA non-coding upstream 136914 5830333 ~ 5830549 (-)
G1656555 NA non-coding upstream 139040 5832459 ~ 5832757 (-)
G1655336 NA other downstream 881275 4805192 ~ 4805580 (-)
LOC110498832 LOC106578311 other downstream 897006 4787586 ~ 4789906 (-)
G1655098 NA other downstream 1322872 4363716 ~ 4363983 (-)
LOC110498829 LOC106578368 other downstream 1353948 4217971 ~ 4333041 (-)
G1656633 LOC106578283 other upstream 164541 5857960 ~ 5861471 (-)
LOC110498853 ube2i other upstream 543386 6236177 ~ 6261266 (-)
LOC110498857 LOC101479821 other upstream 642263 6335525 ~ 6344649 (-)
G1657768 NA other upstream 683993 6377342 ~ 6379507 (-)

Expression


G1656402(yo84) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1656402(yo84) Expression in each Bioproject

Bar chart with 20 bars.
G1656402(yo84) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network