G1661111



Basic Information


Item Value
gene id G1661111
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 9560831 ~ 9567261 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1901034
ctctctctctctctctgccttttctctctctctctctctgccttttctctctctctctctctgccttttctctctctctctctctacgccttttctctctctctctctctccgccttttctctctctctttctgccttttctctctctctctctgccttttctctccttctctctccgccttttctctctctgccttttctctctctctgccttttctctctctctgccttttctctctctctctctaccttctctctctctctccgccttttctctcttgctctctctccgccttttctctctctctctgccttttctctcgctctgccttttctctctctccaccttttctctctctctctctgccttttctctctctctctctctccgccttttctctctctctctctgccttttctctctctctgtcttttctctctctccgccttttctctttctctcgctctgccttttctctctctccaccttttctctctctctctctgccttttctctctctctctctctctccgccttttctctctctctctctgccttttctctctctctgtcttttctctctcttcgccttttatctctctctctctctccgccttttctctctctctctctccgccttttcactctctctctctgccttttctctctctctgccttttctctctctccgccttttctctctctctctctgccttttctctctctctctctgccttttctctctctctctctctgcattttctctctctctctctgcattttctctctctctctgccttttctatctctctctgccttttctatctctctctctgccttttctatctctctctctgccttttctttctctctctctgccttttctctctctctgccttttctctctctctctgccttttctctctctctctgccttttctctctctctctgccttctctctcgccctctatATACTCAGTCCGCGTgccattcctcccctctctctcgacgTCTATATTATCAGTCAGCGTGCcattcctcccctctttctcgaTGTCTATATTATCAGTCAGCGTgccattcctcccctctctctcgccctctataTTCTCAGTCAGCGTgccattcctcccctc
>TU1901035
ctctctgccttttctctctctctctctgccttttctcactctctgccttttctctctctgtgccttttctctctctctctgccttttctctctctgccttttctctctctctctctgccttttctctctctctctctgccttttctctctctgccttttctctctctctctgccttttctctctctctctctgccttttctctctctctctgccttttctctctctctctctctccgccttttctctcgctctctctgccttttctctctctctctctccaccttttctctctctctctctcggccttttctctctctctctccgcctttttatctctctctctccgccttttctctctctctctctctgccttttctctctctctgtcttttctctctcttcgccttttatctctctctctctctccgccttttctctctctctctctccgccttttcactctctctctctgccttttctctctctctgccttttctctctctccgccttttctctctctctctctgccttttctctctctctctctgccttttctctctctctctctctgccctttc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1901034 False 1138 lncRNA 0.49 2 9560831 9564166
TU1901035 True 579 lncRNA 0.49 2 9563403 9567261
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498935 LOC106589231 coding downstream 8094 9548938 ~ 9552737 (-)
nme2a LOC106589447 coding downstream 47133 9506374 ~ 9513698 (-)
trnaa-agc-8 NA coding downstream 231689 9329070 ~ 9329142 (-)
pkd1b LOC106589455 coding downstream 249981 9281357 ~ 9310850 (-)
spata20 spata20 coding downstream 289318 9193289 ~ 9271513 (-)
LOC110498737 ca10 coding upstream 110639 9677900 ~ 9986739 (-)
LOC110498936 LOC106589191 coding upstream 1042486 10609747 ~ 10668872 (-)
LOC110498937 LOC106589191 coding upstream 1136120 10703381 ~ 10704272 (-)
LOC118942033 NA coding upstream 1175687 10742948 ~ 10746240 (-)
LOC110498738 NA coding upstream 1191720 10758981 ~ 10760570 (-)
G1661094 NA non-coding downstream 25255 9535307 ~ 9535576 (-)
G1661061 NA non-coding downstream 77958 9482643 ~ 9482873 (-)
G1661060 NA non-coding downstream 78285 9482265 ~ 9482546 (-)
G1661056 NA non-coding downstream 86022 9474589 ~ 9474809 (-)
G1660999 NA non-coding downstream 121424 9431781 ~ 9439407 (-)
G1661384 NA non-coding upstream 423387 9990648 ~ 9990861 (-)
G1661478 NA non-coding upstream 484318 10051579 ~ 10051913 (-)
G1661479 NA non-coding upstream 484837 10052098 ~ 10052434 (-)
G1661481 NA non-coding upstream 485599 10052860 ~ 10053186 (-)
G1661503 NA non-coding upstream 497313 10064574 ~ 10064846 (-)
G1661001 LOC106589450 other downstream 100716 9422783 ~ 9460115 (-)
G1661023 NA other downstream 159884 9399117 ~ 9400947 (-)
LOC110498913 h3f3b other downstream 1171577 8386968 ~ 8389308 (-)
LOC110498864 LOC106589517 other downstream 2989376 6568700 ~ 6582912 (-)
G1657869 LOC106589521 other downstream 3051251 6509119 ~ 6509580 (-)
G1662039 NA other upstream 909702 10476963 ~ 10477185 (-)
LOC110498953 NA other upstream 1554652 11121913 ~ 11158776 (-)
G1663264 NA other upstream 1975355 11542616 ~ 11543091 (-)
G1664239 NA other upstream 2682889 12250150 ~ 12251106 (-)
G1665402 LOC106589366 other upstream 3834020 13401281 ~ 13407377 (-)

Expression


G1661111 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1661111 Expression in each Bioproject

Bar chart with 9 bars.
G1661111 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network