G1662232



Basic Information


Item Value
gene id G1662232
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 10698430 ~ 10698682 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1902178
atcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccccttaagttaatactatgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgaaattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1902178 True 253 lncRNA 0.40 1 10698430 10698682
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499584 NA coding upstream 657067 10038565 ~ 10041363 (+)
LOC110498736 LOC106589448 coding upstream 1195642 9483623 ~ 9502788 (+)
LOC110499583 NA coding upstream 1216131 9476862 ~ 9482299 (+)
LOC110498932 LOC106589450 coding upstream 1230091 9440645 ~ 9468339 (+)
LOC100305179 gna13 coding downstream 81716 10780398 ~ 10782116 (+)
LOC110499585 NA coding downstream 104045 10802684 ~ 10805251 (+)
LOC110498938 LOC106589439 coding downstream 128082 10826764 ~ 10828429 (+)
LOC110498939 LOC106589440 coding downstream 130536 10829218 ~ 10837113 (+)
LOC110498940 LOC106589438 coding downstream 152088 10850770 ~ 10866995 (+)
G1662219 NA non-coding upstream 20887 10677343 ~ 10677543 (+)
G1662195 NA non-coding upstream 23122 10639121 ~ 10675308 (+)
G1662199 NA non-coding upstream 48355 10645391 ~ 10650075 (+)
G1662097 NA non-coding upstream 175150 10522929 ~ 10523280 (+)
G1662044 NA non-coding upstream 217755 10480418 ~ 10480675 (+)
G1662233 NA non-coding downstream 84 10698766 ~ 10698985 (+)
G1662249 NA non-coding downstream 20013 10718695 ~ 10718907 (+)
G1662355 NA non-coding downstream 24064 10722746 ~ 10727101 (+)
G1662358 NA non-coding downstream 31883 10730565 ~ 10730822 (+)
G1662359 NA non-coding downstream 33421 10732103 ~ 10748344 (+)
G1662037 NA other upstream 221741 10476167 ~ 10476689 (+)
G1661477 NA other upstream 646341 10051622 ~ 10052089 (+)
LOC110498922 cssa28h17orf62 other upstream 2170910 8524125 ~ 8527761 (+)
unk LOC106589472 other upstream 2302954 8392044 ~ 8401533 (+)
G1658572 NA other upstream 2993279 7704506 ~ 7705151 (+)
G1662536 LOC106589414 other downstream 606128 11304810 ~ 11306183 (+)
LOC110498741 LOC106589412 other downstream 674185 11372725 ~ 11404820 (+)
LOC110498970 cript other downstream 851114 11549728 ~ 11553514 (+)

Expression


G1662232 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1662232 Expression in each Bioproject

Bar chart with 16 bars.
G1662232 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network