G1663314



Basic Information


Item Value
gene id G1663314
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 11651964 ~ 11653271 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1903442
TATGGCTAGTAGACTAGAGAAACATTTACTACCCTCACACACTAACAGTATGACTAGTAGACTAGAGAAACATTTACTACCCTCAGACACTAACAGTATGACTAGTAGACTAGAGAAACATTTACTACCCTCAGACACTAACAGTATGGCTAGTTGACTAGAGAAACATTTACTACCCTCACACACTAACAGTATGGCCCGTAGACTGGAGAAACATTTACTACCCTCACACACTAACAGTATGGCCCGTAGACTAGAGAAACATTTACTACCCTCAGACACTAACAGTATGGCCCGTAGACTAGAGAAACATTTACT
>TU1903440
CACTAACAGTATGACTAGTAGACTGGAGAAACATTTACTACCCTCAGACACTAACAGTATGGCTAGTTGACTAGAGAAACATTTACTACCCTCACACACTAACAGTATGGCTAGTAGACTAGAGAAACATTTACTACCCTCAGACACTAACAGTATGACTAGTAGACTAGAGAAACATTTACTACCCTCAGACACTAACAGTATGACTAGTAGACTAGAGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1903442 False 318 lncRNA 0.41 3 11651964 11653118
TU1903440 True 221 lncRNA 0.39 3 11652502 11653271
Loading

Neighbor


gene id symbol gene type direction distance location
fshr fshr coding downstream 17151 11624909 ~ 11634813 (-)
LOC110498972 LOC106589404 coding downstream 32392 11603242 ~ 11619572 (-)
LOC110498968 LOC106589406 coding downstream 87040 11555259 ~ 11564924 (-)
LOC110498969 pigf coding downstream 102270 11547443 ~ 11549694 (-)
LOC110498965 LOC106589409 coding downstream 142699 11498540 ~ 11509265 (-)
LOC110498976 LOC106589228 coding upstream 519341 12172612 ~ 12174808 (-)
LOC110498977 LOC106589397 coding upstream 525221 12178492 ~ 12347526 (-)
asah2 asah2 coding upstream 718303 12371574 ~ 12387861 (-)
sgms1 LOC106589394 coding upstream 735112 12388383 ~ 12402840 (-)
LOC110498983 LOC106589392 coding upstream 794476 12447747 ~ 12458329 (-)
G1663311 NA non-coding downstream 10557 11641195 ~ 11641407 (-)
G1663266 NA non-coding downstream 106364 11545250 ~ 11545600 (-)
G1663265 NA non-coding downstream 107953 11543644 ~ 11544011 (-)
G1663261 NA non-coding downstream 112721 11536901 ~ 11539243 (-)
G1663319 NA non-coding upstream 5744 11659015 ~ 11659454 (-)
G1663338 NA non-coding upstream 53459 11706730 ~ 11712672 (-)
G1663339 NA non-coding upstream 65005 11718276 ~ 11718478 (-)
G1663341 NA non-coding upstream 70931 11724202 ~ 11724554 (-)
G1663346 NA non-coding upstream 78062 11731333 ~ 11731583 (-)
G1663264 NA other downstream 108873 11542616 ~ 11543091 (-)
LOC110498953 NA other downstream 493188 11121913 ~ 11158776 (-)
G1662039 NA other downstream 1174779 10476963 ~ 10477185 (-)
G1661001 LOC106589450 other downstream 2191849 9422783 ~ 9460115 (-)
G1661023 NA other downstream 2251017 9399117 ~ 9400947 (-)
G1664239 NA other upstream 596879 12250150 ~ 12251106 (-)
G1665402 LOC106589366 other upstream 1748010 13401281 ~ 13407377 (-)
G1666656 LOC106589183 other upstream 2568928 14222199 ~ 14223019 (-)
G1666788 NA other upstream 2771702 14424973 ~ 14425314 (-)
LOC110499033 LOC107708254 other upstream 2971084 14616546 ~ 14647860 (-)

Expression


G1663314 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1663314 Expression in each Bioproject

Bar chart with 13 bars.
G1663314 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network