G1666788



Basic Information


Item Value
gene id G1666788
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 14424973 ~ 14425314 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1907198
gagggagggcctgtcatggtctggggtgatgtgtcacagcatcatcggactgagcttgttgtcattgcaggcaatgtcaacgctgtgcgttacagggaagacatcctcctccctcatgtggtacccttcctgcaggctcatcctaacatgaccctccagcatgacaatgccaccagccatactgctcgttctgtacgtgatttcctgcaagacaggaatgtcagttttttgccagcaaagagcccggatctcaatcccattgagcacgtttgggacctgttggatcggatggtgagggctagggccattccccccagaaatgtccgggaacttgcaggtgcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1907198 True 342 TUCP 0.54 1 14424973 14425314
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499016 LOC106589362 coding downstream 154094 14223170 ~ 14270879 (-)
LOC110499015 LOC106589364 coding downstream 331150 13668937 ~ 14093823 (-)
LOC118942003 NA coding downstream 874125 13542821 ~ 13550848 (-)
LOC110498744 NA coding downstream 1115596 13306190 ~ 13309377 (-)
cep55l cep55 coding downstream 1152663 13257333 ~ 13272310 (-)
LOC110499023 argi1 coding upstream 37083 14462397 ~ 14468271 (-)
heatr1 heatr1 coding upstream 43152 14468466 ~ 14492898 (-)
LOC118942475 NA coding upstream 56078 14481392 ~ 14481522 (-)
LOC110499028 cssa28h16orf62 coding upstream 103700 14529014 ~ 14544454 (-)
LOC110499027 LOC106589352 coding upstream 133347 14558661 ~ 14572216 (-)
G1666697 NA non-coding downstream 213915 14210838 ~ 14211058 (-)
G1666640 NA non-coding downstream 295766 14128480 ~ 14129207 (-)
G1666557 NA non-coding downstream 414745 14009894 ~ 14010228 (-)
G1665526 NA non-coding downstream 835535 13589218 ~ 13589438 (-)
G1665419 NA non-coding downstream 993352 13430707 ~ 13431621 (-)
G1666832 NA non-coding upstream 14861 14440175 ~ 14440400 (-)
G1666782 NA non-coding upstream 29228 14454542 ~ 14458831 (-)
G1666780 NA non-coding upstream 69661 14494975 ~ 14508286 (-)
G1666875 NA non-coding upstream 163665 14588979 ~ 14591016 (-)
LOC110499033 LOC107708254 non-coding upstream 191397 14616546 ~ 14647860 (-)
G1666656 LOC106589183 other downstream 201954 14222199 ~ 14223019 (-)
G1665402 LOC106589366 other downstream 1017596 13401281 ~ 13407377 (-)
G1664239 NA other downstream 2173867 12250150 ~ 12251106 (-)
G1663264 NA other downstream 2881882 11542616 ~ 11543091 (-)
LOC110498953 NA other downstream 3266197 11121913 ~ 11158776 (-)
G1667100 LOC106589344 other upstream 465061 14890375 ~ 14897681 (-)
G1667916 NA other upstream 914371 15339685 ~ 15415178 (-)
LOC110498749 s39ab other upstream 1141244 15421293 ~ 15577049 (-)
LOC110498751 LOC106589337 other upstream 1211831 15636400 ~ 15680564 (-)

Expression


G1666788 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1666788 Expression in each Bioproject

Bar chart with 20 bars.
G1666788 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network