G1672696



Basic Information


Item Value
gene id G1672696
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 20811161 ~ 20811373 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1913776
gttctcatccacatcacaatggatgttttcattagccaaaaatcttgggaagaatcttcgggcgaatccaggcctgacactggtctgccgtgatgtcattgcatgcgtcatccatggcctggagaagggtggcttgttcgtgagggcgcctaccttccacctccatgtggagaaaaattcctcaatcgggttaaggaaaggagagtatagggg

Function


NR:

description
PREDICTED: tomoregulin-1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1913776 True 213 lncRNA 0.50 1 20811161 20811373
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499110 LOC106589303 coding downstream 3651 20766123 ~ 20807510 (-)
LOC110499116 wnt3 coding downstream 403812 20368996 ~ 20407349 (-)
LOC110499118 LOC106589297 coding downstream 502387 20297544 ~ 20308774 (-)
trnaa-ugc-145 NA coding downstream 644456 20166636 ~ 20166705 (-)
LOC110499121 LOC106589293 coding downstream 684574 20013073 ~ 20126587 (-)
LOC110499109 LOC106589309 coding upstream 50977 20862350 ~ 20872069 (-)
LOC118941997 LOC106589179 coding upstream 143826 20955199 ~ 20957806 (-)
LOC118942009 NA coding upstream 166850 20978223 ~ 20979539 (-)
LOC110499105 LOC106589523 coding upstream 380238 21191611 ~ 21214252 (-)
LOC110499589 NA coding upstream 408062 21219435 ~ 21221837 (-)
G1672618 NA non-coding downstream 37410 20671156 ~ 20773751 (-)
G1672636 NA non-coding downstream 73960 20713319 ~ 20737201 (-)
G1672588 NA non-coding downstream 141098 20620742 ~ 20670417 (-)
G1672578 NA non-coding downstream 213489 20597437 ~ 20597672 (-)
G1672566 NA non-coding downstream 236630 20574305 ~ 20574531 (-)
G1672743 NA non-coding upstream 64258 20875631 ~ 20875869 (-)
G1672750 NA non-coding upstream 68705 20880078 ~ 20880415 (-)
G1672760 NA non-coding upstream 85379 20896752 ~ 20896993 (-)
G1672764 NA non-coding upstream 101693 20913066 ~ 20913535 (-)
G1672767 NA non-coding upstream 138670 20950043 ~ 20950351 (-)
G1672649 dhx8 other downstream 81089 20729275 ~ 20730072 (-)
G1672381 LOC106589294 other downstream 559996 20249459 ~ 20251165 (-)
G1671895 LOC107575789 other downstream 1376120 19432139 ~ 19435041 (-)
G1671859 LOC106589268 other downstream 1404230 19326814 ~ 19406931 (-)
phf5a LOC102780084 other upstream 777656 21589006 ~ 21596518 (-)
G1673740 LOC106589538 other upstream 1024960 21836333 ~ 21844793 (-)
G1674299 NA other upstream 1519977 22331350 ~ 22331806 (-)
LOC118942052 mkl2 other upstream 1574950 22386323 ~ 22391573 (-)
LOC110499164 litaf other upstream 1580444 22391641 ~ 22395025 (-)

Expression


G1672696 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1672696 Expression in each Bioproject

Bar chart with 13 bars.
G1672696 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network