G1672750



Basic Information


Item Value
gene id G1672750
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 20880078 ~ 20880415 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1913835
AACTCACAGAGATTCGGGACAGAGTGTTGGCAGACAATGTAAGCAACATCAAGTCAGGATGAAGCAGTTGCGCACTGTCCCCTTTGAGAGGAACTCTGAACGAGTCAAGCAACTCAGGAACCAATAAGTCCAGGTAAGATGACTATAAAATATAGTACTGGTTTTGAACAAAACCAAACAGGGCAGAGGCACACAATGGCATGTTTTAAGGTATAATGTAAACTACCGTAATAGCCTAACTCTTATGTTGTCTTGTGGATTTATTTTAGAGAGTCATGGAGATTGAAGCCAGGCAAACTCCCTACATATTCATCTTTGTGGATGAGGCTGGTTTCAAC

Function


NR:

description
PREDICTED: uncharacterized protein LOC109204545

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1913835 True 338 lncRNA 0.42 1 20880078 20880415
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499109 LOC106589309 coding downstream 8009 20862350 ~ 20872069 (-)
LOC110499110 LOC106589303 coding downstream 72568 20766123 ~ 20807510 (-)
LOC110499116 wnt3 coding downstream 472729 20368996 ~ 20407349 (-)
LOC110499118 LOC106589297 coding downstream 571304 20297544 ~ 20308774 (-)
trnaa-ugc-145 NA coding downstream 713373 20166636 ~ 20166705 (-)
LOC118941997 LOC106589179 coding upstream 74784 20955199 ~ 20957806 (-)
LOC118942009 NA coding upstream 97808 20978223 ~ 20979539 (-)
LOC110499105 LOC106589523 coding upstream 311196 21191611 ~ 21214252 (-)
LOC110499589 NA coding upstream 339020 21219435 ~ 21221837 (-)
LOC110499102 LOC106589526 coding upstream 505898 21386313 ~ 21401314 (-)
G1672743 NA non-coding downstream 4209 20875631 ~ 20875869 (-)
G1672696 NA non-coding downstream 68705 20811161 ~ 20811373 (-)
G1672618 NA non-coding downstream 106327 20671156 ~ 20773751 (-)
G1672636 NA non-coding downstream 142877 20713319 ~ 20737201 (-)
G1672588 NA non-coding downstream 210015 20620742 ~ 20670417 (-)
G1672760 NA non-coding upstream 16337 20896752 ~ 20896993 (-)
G1672764 NA non-coding upstream 32651 20913066 ~ 20913535 (-)
G1672767 NA non-coding upstream 69628 20950043 ~ 20950351 (-)
G1672855 NA non-coding upstream 159760 21040175 ~ 21041852 (-)
G1672864 NA non-coding upstream 167758 21048173 ~ 21048375 (-)
G1672649 dhx8 other downstream 150006 20729275 ~ 20730072 (-)
G1672381 LOC106589294 other downstream 628913 20249459 ~ 20251165 (-)
G1671895 LOC107575789 other downstream 1445037 19432139 ~ 19435041 (-)
G1671859 LOC106589268 other downstream 1473147 19326814 ~ 19406931 (-)
phf5a LOC102780084 other upstream 708614 21589006 ~ 21596518 (-)
G1673740 LOC106589538 other upstream 955918 21836333 ~ 21844793 (-)
G1674299 NA other upstream 1450935 22331350 ~ 22331806 (-)
LOC118942052 mkl2 other upstream 1505908 22386323 ~ 22391573 (-)
LOC110499164 litaf other upstream 1511402 22391641 ~ 22395025 (-)

Expression


G1672750 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1672750 Expression in each Bioproject

Bar chart with 14 bars.
G1672750 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network