G1673044



Basic Information


Item Value
gene id G1673044
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 21296372 ~ 21296854 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1914145
ggtcctcatcagacatcagtggcaacaacgttgcctatgggcacaaacccactgttgctggaccagacaggactggcaaaaagtgctcttcactgacgagtcgcggttttgtctcaccaggggtgatggtcggattcgcttttatcgtcaaaggaatgagcgttacaccgaggcctgtactctggagcgtgatctatttggaggtggagggtccatcatggtctggggcggtgtgtcacagcatcatcggactgagcttgttgtcattgcaggcaatctccacgctgtgcgttacaggaaagacatcctcctccctcatgtcgtacccttcctgcaggctcatcctgacatgaccctccagcatgacaatgccaccagccatactgctcattctgtgcgtgatttcctgcaagacaagaatgtcattgttctgccatggccagcgaagagcccggatctcaatcccattgagcacttctggga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1914145 True 483 TUCP 0.53 1 21296372 21296854
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499104 LOC106589524 coding upstream 18755 21234211 ~ 21277617 (+)
trnal-uag-53 NA coding upstream 67768 21228523 ~ 21228604 (+)
LOC110499107 LOC106578254 coding upstream 127718 21154535 ~ 21168654 (+)
LOC110499108 LOC106578253 coding upstream 256261 21002651 ~ 21040111 (+)
LOC110499111 LOC106589301 coding upstream 532290 20735432 ~ 20764082 (+)
LOC110499103 LOC106589525 coding downstream 35440 21332294 ~ 21377525 (+)
LOC110499101 ku70 coding downstream 108668 21405522 ~ 21420610 (+)
LOC110499100 LOC106589528 coding downstream 125314 21422168 ~ 21437402 (+)
LOC110499099 LOC106589529 coding downstream 140681 21437535 ~ 21442026 (+)
LOC118941998 NA coding downstream 199540 21496394 ~ 21517265 (+)
G1673036 NA non-coding upstream 11382 21284780 ~ 21284990 (+)
G1673011 NA non-coding upstream 83024 21212402 ~ 21213348 (+)
G1672983 NA non-coding upstream 102408 21191637 ~ 21193964 (+)
G1672968 NA non-coding upstream 161445 21134727 ~ 21134927 (+)
G1672922 NA non-coding upstream 198892 21093726 ~ 21097480 (+)
G1673057 NA non-coding downstream 14888 21311742 ~ 21312101 (+)
G1673183 NA non-coding downstream 57709 21354563 ~ 21354777 (+)
G1673166 NA non-coding downstream 85885 21382739 ~ 21383609 (+)
G1673251 NA non-coding downstream 181778 21478632 ~ 21536718 (+)
G1672973 NA other upstream 105294 21140525 ~ 21191078 (+)
G1672918 NA other upstream 206542 21089403 ~ 21089830 (+)
G1671091 NA other upstream 1068204 20227795 ~ 20228168 (+)
LOC110499153 LOC106589263 other upstream 2171136 19094882 ~ 19201695 (+)
G1670209 LOC105007702 other upstream 3175205 18051611 ~ 18132470 (+)
G1673063 NA other downstream 19944 21316798 ~ 21317412 (+)
G1673204 NA other downstream 89475 21386329 ~ 21389778 (+)
G1673231 LOC106589530 other downstream 148029 21444883 ~ 21450346 (+)
tnrc6b LOC106589538 other downstream 516391 21806703 ~ 21848442 (+)

Expression


G1673044 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1673044 Expression in each Bioproject

Bar chart with 21 bars.
G1673044 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network