G1673183



Basic Information


Item Value
gene id G1673183
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 21354563 ~ 21354777 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1914299
gaaacactcaaagaatatggctgcctaaatatggttcccaatcagagacaacgataaacacctgcctctgattgagaaccacttcagacagccatagacttaacaagaacaccccactaagctacaatcccaataccaacacaccacataacaaaaacccatgccacaccctggcctgagcaaataaatgaagataaacacaaaatacttcgacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1914299 True 215 lncRNA 0.42 1 21354563 21354777
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110499104 LOC106589524 coding upstream 76946 21234211 ~ 21277617 (+)
trnal-uag-53 NA coding upstream 125959 21228523 ~ 21228604 (+)
LOC110499107 LOC106578254 coding upstream 185909 21154535 ~ 21168654 (+)
LOC110499108 LOC106578253 coding upstream 314452 21002651 ~ 21040111 (+)
LOC110499111 LOC106589301 coding upstream 590481 20735432 ~ 20764082 (+)
LOC110499101 ku70 coding downstream 50745 21405522 ~ 21420610 (+)
LOC110499100 LOC106589528 coding downstream 67391 21422168 ~ 21437402 (+)
LOC110499099 LOC106589529 coding downstream 82758 21437535 ~ 21442026 (+)
LOC118941998 NA coding downstream 141617 21496394 ~ 21517265 (+)
LOC110499098 NA coding downstream 163568 21518345 ~ 21562573 (+)
G1673057 NA non-coding upstream 42462 21311742 ~ 21312101 (+)
G1673036 NA non-coding upstream 69573 21284780 ~ 21284990 (+)
G1673011 NA non-coding upstream 141215 21212402 ~ 21213348 (+)
G1672983 NA non-coding upstream 160599 21191637 ~ 21193964 (+)
G1672968 NA non-coding upstream 219636 21134727 ~ 21134927 (+)
G1673166 NA non-coding downstream 27962 21382739 ~ 21383609 (+)
G1673251 NA non-coding downstream 123855 21478632 ~ 21536718 (+)
G1673333 NA non-coding downstream 266674 21621451 ~ 21621681 (+)
G1673334 NA non-coding downstream 268431 21623208 ~ 21623435 (+)
G1673063 NA other upstream 37151 21316798 ~ 21317412 (+)
G1673044 NA other upstream 57709 21296372 ~ 21296854 (+)
G1672973 NA other upstream 163485 21140525 ~ 21191078 (+)
G1672918 NA other upstream 264733 21089403 ~ 21089830 (+)
G1671091 NA other upstream 1126395 20227795 ~ 20228168 (+)
G1673204 NA other downstream 31552 21386329 ~ 21389778 (+)
G1673231 LOC106589530 other downstream 90106 21444883 ~ 21450346 (+)
tnrc6b LOC106589538 other downstream 458468 21806703 ~ 21848442 (+)
LOC110513322 rsl1d1 other downstream 581865 21936590 ~ 21959627 (+)

Expression


G1673183 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1673183 Expression in each Bioproject

Bar chart with 13 bars.
G1673183 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network