G1673778



Basic Information


Item Value
gene id G1673778
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 21901867 ~ 21902080 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1915005
CTTGGCTGTGTCGTTGGAGAGTACCAGCTGCCAGTCCTTCAGTTGTCAACACAATTGTATAAACAAATGTTTTTAAAACACGGGGAAACGTCAAATACTGTGTTCAAGTCGAAGCGAGTCAAGCGACAAAATGTCAGTTCGCCTTTTCCCGGAATTACTCTGTTCTGTGGGGTTGGATTCTTTCATTCACAAAAAACACCGTTACAATGACGTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1915005 True 214 lncRNA 0.43 1 21901867 21902080

Neighbor


gene id symbol gene type direction distance location
tmem184ba LOC106609488 coding upstream 7310 21876875 ~ 21894557 (+)
LOC110499080 LOC106609470 coding upstream 25408 21867834 ~ 21876459 (+)
tnrc6b LOC106589538 coding upstream 53425 21806703 ~ 21848442 (+)
sh3bp1 LOC106589540 coding upstream 146291 21739960 ~ 21755576 (+)
LOC110499089 LOC106589537 coding upstream 172507 21725548 ~ 21729360 (+)
tomm22 LOC106589546 coding downstream 525 21902605 ~ 21907221 (+)
dmc1 LOC106609504 coding downstream 5537 21907617 ~ 21919609 (+)
gspt1 gspt1 coding downstream 22745 21924825 ~ 21936465 (+)
LOC110513322 rsl1d1 coding downstream 34510 21936590 ~ 21959627 (+)
LOC118942478 NA coding downstream 39640 21941720 ~ 21941847 (+)
G1673775 LOC106589545 non-coding upstream 1685 21896765 ~ 21900182 (+)
G1673768 NA non-coding upstream 35772 21865886 ~ 21866095 (+)
G1673766 NA non-coding upstream 37185 21864483 ~ 21864682 (+)
G1673765 NA non-coding upstream 38051 21863587 ~ 21863816 (+)
G1673759 NA non-coding upstream 41711 21859936 ~ 21860156 (+)
G1673797 NA non-coding downstream 41948 21944028 ~ 21950021 (+)
G1673798 NA non-coding downstream 47167 21949247 ~ 21955161 (+)
G1673803 NA non-coding downstream 63854 21965934 ~ 21966202 (+)
G1673783 NA non-coding downstream 66557 21968637 ~ 21971293 (+)
LOC110499590 tnfrsf17 non-coding downstream 70779 21972738 ~ 21974195 (+)
G1673231 LOC106589530 other upstream 451521 21444883 ~ 21450346 (+)
LOC110499100 LOC106589528 other upstream 464486 21422168 ~ 21437402 (+)
G1673204 NA other upstream 512089 21386329 ~ 21389778 (+)
G1673063 NA other upstream 584455 21316798 ~ 21317412 (+)
LOC110499192 LOC106589579 other downstream 1354724 23252800 ~ 23269058 (+)
faap100 faap100 other downstream 1677950 23576429 ~ 23582556 (+)
G1677419 LOC100194703 other downstream 3180584 25082664 ~ 25083277 (+)
G1677738 NA other downstream 3734611 25636691 ~ 25641614 (+)

Expression


G1673778 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1673778 Expression in each Bioproject

Bar chart with 13 bars.
G1673778 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network