G1673803



Basic Information


Item Value
gene id G1673803
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 21965934 ~ 21966202 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1915030
CCCTATTTGATGTGGGTGTGGTTAACTGGGTGGAAATAGATGGGATGAGGGGAGTGGGGTTTTAGGAAACAACAGAGCAGTCATCAGTAGGGAGGTTGTAGTTGGTAAGCATTAGAAATCTTATATTGCAGAAGAAAAAGTATACATGTTAATGCAAGTTAGTTGCCGTTGTCCAAGAGGTCATGAAGTGAAACACAAATTGGGTCTCCAAAATATAAATCTATTTCACATTGAGGAACAATTGCAGTTTAGTAAGGGCAGCTTTTCAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1915030 True 269 lncRNA 0.40 1 21965934 21966202

Neighbor


gene id symbol gene type direction distance location
LOC110513322 rsl1d1 coding upstream 6408 21936590 ~ 21959627 (+)
LOC118942480 NA coding upstream 12799 21953008 ~ 21953135 (+)
LOC118942479 NA coding upstream 18409 21947398 ~ 21947525 (+)
LOC118942478 NA coding upstream 24087 21941720 ~ 21941847 (+)
gspt1 gspt1 coding upstream 29469 21924825 ~ 21936465 (+)
LOC110499590 tnfrsf17 coding downstream 6536 21972738 ~ 21974195 (+)
snx29 snx29 coding downstream 8136 21974338 ~ 22091580 (+)
cpped1 cpped1 coding downstream 285929 22252131 ~ 22318724 (+)
LOC118942051 NA coding downstream 294545 22260747 ~ 22281843 (+)
ercc4 ercc4 coding downstream 374527 22340729 ~ 22347757 (+)
G1673798 NA non-coding upstream 10773 21949247 ~ 21955161 (+)
G1673797 NA non-coding upstream 15913 21944028 ~ 21950021 (+)
G1673778 NA non-coding upstream 63854 21901867 ~ 21902080 (+)
G1673775 LOC106589545 non-coding upstream 65752 21896765 ~ 21900182 (+)
G1673768 NA non-coding upstream 99839 21865886 ~ 21866095 (+)
G1673783 NA non-coding downstream 2435 21968637 ~ 21971293 (+)
G1673838 NA non-coding downstream 76241 22042443 ~ 22044388 (+)
G1673841 NA non-coding downstream 82552 22048754 ~ 22050773 (+)
G1674064 NA non-coding downstream 228777 22194979 ~ 22195354 (+)
tnrc6b LOC106589538 other upstream 120068 21806703 ~ 21848442 (+)
G1673231 LOC106589530 other upstream 515588 21444883 ~ 21450346 (+)
LOC110499100 LOC106589528 other upstream 528553 21422168 ~ 21437402 (+)
G1673204 NA other upstream 576156 21386329 ~ 21389778 (+)
LOC110499192 LOC106589579 other downstream 1290602 23252800 ~ 23269058 (+)
faap100 faap100 other downstream 1613828 23576429 ~ 23582556 (+)
G1677419 LOC100194703 other downstream 3116462 25082664 ~ 25083277 (+)
G1677738 NA other downstream 3670489 25636691 ~ 25641614 (+)
G1678963 NA other downstream 4495992 26462194 ~ 26467953 (+)

Expression


G1673803 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1673803 Expression in each Bioproject

Bar chart with 10 bars.
G1673803 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network