G1676620



Basic Information


Item Value
gene id G1676620
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 24413812 ~ 24414403 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1918206
ggtaagtaacattataaggtagcattgtttaaagtggctagtgatatatttacataatttcccatcaattcccattattaaagtggctggagttgagtcagtgtcagtgtgttggcagcagccactcaatgttagtggtggctgtttaacagtctgatggccttgagatagaagctgtttttcagtctctcggtcccagctttgatgcacctgtactgacctcgccttctggatgatagcggggtgaacaggcagtggctcgggtggttgatgatctttatggccttcctgtgacatcgggtggtgtaggtgtcctggagggcaggtagtttgcccccggtgatgcgttgtgcagacctcactaccctctggagagccttacggttgagggcggagcagttgccgtaccaggcggtgatacagcccgccaggatgctctcgattgtacatctgtagaagtttgtgtgcttttggtgacaagccgaatttcttcagcctcctgaggttgaagaggcgctgctgcgccttcttcacaatgctgtctgtgtgagtggaccaattcagtttgtctgtgatgtgtatgccgaggaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1918206 True 592 lncRNA 0.50 1 24413812 24414403
Loading

Neighbor


gene id symbol gene type direction distance location
rpl38 NA coding downstream 929 24407459 ~ 24412883 (-)
ttyh2 LOC106589617 coding downstream 9715 24286893 ~ 24404097 (-)
LOC110498776 dnai2 coding downstream 132929 24271012 ~ 24280883 (-)
LOC110499235 kif19 coding downstream 142742 24192091 ~ 24271070 (-)
LOC110499233 csnk1d coding downstream 227294 24172966 ~ 24186518 (-)
LOC110499238 NA coding upstream 242205 24656608 ~ 24663416 (-)
si:ch211-152f22.4 NA coding upstream 998721 25413124 ~ 25421069 (-)
pmp22b pmp22 coding upstream 1016039 25430442 ~ 25445125 (-)
tekt3 tekt3 coding upstream 1044776 25459179 ~ 25489629 (-)
LOC118942473 NA coding upstream 1190967 25605370 ~ 25605422 (-)
G1676617 NA non-coding downstream 7048 24406547 ~ 24406764 (-)
G1676451 NA non-coding downstream 236858 24168608 ~ 24176954 (-)
G1676452 NA non-coding downstream 249192 24159015 ~ 24164620 (-)
G1676442 NA non-coding downstream 318460 24095067 ~ 24095352 (-)
G1676403 NA non-coding downstream 428392 23985088 ~ 23985420 (-)
G1676624 NA non-coding upstream 1319 24415722 ~ 24416225 (-)
G1676638 NA non-coding upstream 10730 24425133 ~ 24425346 (-)
G1676643 NA non-coding upstream 14218 24428621 ~ 24429099 (-)
G1676745 NA non-coding upstream 100837 24515240 ~ 24515670 (-)
G1676756 NA non-coding upstream 111078 24525481 ~ 24525710 (-)
G1676051 ccz1 other downstream 1081732 23329897 ~ 23332080 (-)
LOC118942011 NA other downstream 1209723 23192192 ~ 23204089 (-)
G1675801 LOC107699850 other downstream 1549466 22857113 ~ 22864346 (-)
msrb1b LOC100705913 other downstream 1575931 22835823 ~ 22837899 (-)
G1676904 NA other upstream 223940 24638343 ~ 24638701 (-)
G1677008 NA other upstream 295722 24710125 ~ 24710498 (-)
G1678242 cdc42ep4 other upstream 973478 25387881 ~ 25392576 (-)
G1678462 NA other upstream 1290218 25704621 ~ 25705124 (-)
fbxw10 cdrt1 other upstream 1795051 26208532 ~ 26229024 (-)

Expression


G1676620 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1676620 Expression in each Bioproject

Bar chart with 20 bars.
G1676620 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network